Follow us on :


Take a look at the Recent articles

The evidence of genetic polymorphisms of genes involved in the P2RX7 signaling pathway as predictive biomarkers for response and loss of response to infliximab against Crohn's disease

Araki C

Department of Pharmacotherapeutics, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki, Japan

Department of Pharmacy, Nagasaki Harbor Medical Center City Hospital, Shinchi-machi, Nagasaki

E-mail : aa

Yoshimura M

Department of Pharmacotherapeutics, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki, Japan

Fukumitsu Y

Department of Pharmacotherapeutics, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki, Japan

Ma S

Department of Pharmacotherapeutics, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki, Japan

Ishida T

Department of Gastroenterology, Oita Red Cross Hospital, Chiyo-machi, Oita, Japan

Urabe S

Department of Gastroenterology and Hepatology, Nagasaki University Graduate School of Biomedical Sciences, Sakamoto, Nagasaki, Japan

Matsushima K

Department of Gastroenterology and Hepatology, Nagasaki University Graduate School of Biomedical Sciences, Sakamoto, Nagasaki, Japan

Honda T

Department of Gastroenterology and Hepatology, Nagasaki Harbor Medical Center City Hospital, Shinchi-machi, Nagasaki, Japan

Uehara R

Department of Gastroenterology and Hepatology, Nagasaki Harbor Medical Center City Hospital, Shinchi-machi, Nagasaki, Japan

Fukuda Y

Department of Gastroenterology and Hepatology, Nagasaki University Graduate School of Biomedical Sciences, Sakamoto, Nagasaki, Japan

Takeshima F

Department of Gastroenterology and Hepatology, Nagasaki University Graduate School of Biomedical Sciences, Sakamoto, Nagasaki, Japan

Higuchi N

Department of Pharmacy, Nagasaki Harbor Medical Center City Hospital, Shinchi-machi, Nagasaki 850-8555, Japan

Isomoto H

Division of Medicine and Clinical Science, Department of Multidisciplinary Internal Medicine, Faculty of Medicine, Tottori University, Nishi-cho, Yonago, Japan

Nakao K

Department of Gastroenterology and Hepatology, Nagasaki University Graduate School of Biomedical Sciences, Sakamoto, Nagasaki, Japan

Tsukamoto K

Department of Pharmacotherapeutics, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki, Japan

DOI: 10.15761/IMM.1000262

Article
Article Info
Author Info
Figures & Data

Abstract

Infliximab (IFX) is a chimeric anti-tumor necrosis factor-α monoclonal antibody exerting the therapeutic effect for Crohn’s disease (CD). To identify certain genes related to the effect of IFX and biomarkers to predict the effect of IFX, we examined an association study between 35 tag single nucleotide polymorphisms (SNPs) in six candidate genes involved in the P2RX7 signaling pathway and response to IFX after 10 weeks, 1 year, and 2 years of treatment for Japanese CD patients. A total of 127 CD patients were divided into two groups, including responders and non-responders, at each period of IFX treatment. The frequencies of alleles and genotyped at each tag SNP between responders and non-responders were compared in three different inheritance models at each period of treatment. Statistical analyses indicated that polymorphism of rs11670259 in CARD8 contributed to response and primary non-response to IFX after 10 weeks of treatment, and that polymorphisms of P2RX7, CARD8, and CASP1 independently contributed to response and secondary loss of response to IFX after 1 year of treatment. Subsequently, using the associated tag SNPs as a biomarker, genetic test revealed that the polymorphism of CARD8 and the combination polymorphisms of P2RX7 and CASP1 were useful as a biomarker to predict response to IFX after 10 weeks and 1 year of treatment, respectively. Therefore, CARD8 is an IFX-related gene after 10 weeks of treatment, and P2RX7, CARD8, and CASP1 are IFX-related genes after 1 year of treatment for Japanese CD patients. These genes in the P2RX7 signaling pathway could therefore be potential targets for new therapeutic drugs to combat primary non-response and secondary loss of response to IFX for CD patients.

Key words

P2RX7 signaling pathway, single nucleotide polymorphism, infliximab, drug-responsibility gene, Crohn's disease, candidate gene-based association study, DNA-based biomarker

Abbreviations

 ASC: apoptosis-associated speck-like protein containing a card; ATI: antibodies to IFX; CARD8: caspase recruitment domain-containing protein 8; CASP1: caspase 1; CD: Crohn’s disease; CDAI: Crohn’s disease activity index; HWE: Hardy-Weinberg equilibrium; IFX: infliximab; IL: interleukin; NF-kB: nuclear factor kappa-B; NLRP3: NLR family pyrin domain-containing 3; P2RX7: purinergic receptor P2X, ligand-gated ion channel, 7; SNPs: single nucleotide polymorphisms; TNF-α anti-tumor necrosis factor-alpha; TNFR: TNF receptor

Introduction

Crohn’s disease (CD) is pathophysiologically characterized by granulomatous inflammation in the gastrointestinal tract with the dysfunction of both the mucosal immune system and inflammatory response. Although the etiology of CD is still unknown, many genetic and environmental factors contribute to the onset of CD, because this disorder is one of the multifactorial disorders [1-3]. Since no fundamental therapies for CD have yet been established, CD treatment is determined according to the present site of the lesions, the degree of inflammation, response to the past treatment, and the presence or absence of complications in order to induce remission as early as possible [4].

  Infliximab (IFX) is a chimeric anti-tumor necrosis factor-α (TNF-α) monoclonal antibody, which is used for the CD patients with moderate to severe disease activity [4-6]. A randomized clinical trial using a 5 mg/kg intravenous infusion of IFX (ACCENT I) has revealed that 58% of all patients showed good response to IFX after 2 weeks of treatment. However, among the responders after 2 weeks, 22% of the patients discontinued maintenance treatment by 54 weeks of the treatment period [7]. Therefore, response to the therapeutic drugs for CD as well as susceptibility to the onset of CD are involved as a multifactorial complex.

   Some association studies using single nucleotide polymorphisms (SNPs) have shown the possible IFX-related genes for rheumatoid arthritis, such as TNF receptor (TNFR) superfamily member 1B [8], Fc gamma receptors IIA and IIIA [9], AFF3 [10], CD226 [10], protein tyrosine phosphatase receptor type C [11], and p38 mitogen-activated protein kinase [12]. While, our previous study has reported that the polymorphisms of IL17F and TRAF3IP2 are associated with response to IFX after 1 year of treatment for Japanese CD patients [13]. As the results, we next focused on the purinergic receptor P2X, ligand-gated ion channel, 7 (P2RX7/P2RX7) signaling pathway, which is related to intestinal inflammation through another non-TNF-dependent inflammation signaling pathway.

  P2RX7 is a ligand-gated membrane ion channel which plays a crucial role in many cellular functions, such as vascular reactivity, apoptosis, cytokine secretion, and tissue inflammation [14]. This purinergic receptor is expressed in peripheral macrophages, mast cells, lymphocytes, erythrocytes, fibroblasts, microglia, astrocytes, Schwann cells, and dendritic cells, and is activated by high concentrations of extracellular ATP [15], thus resulting in the opening of ion channels and subsequently leading to the influx of Ca2+ and the efflux of K+. The increase in cytosolic Ca2+ and subsequent decrease in intracellular K+ activate the assembly of caspase recruitment domain-containing protein 8 (CARD8/CARD8), NLR family pyrin domain-containing 3 (NLRP3/NLRP3), apoptosis-associated speck-like protein containing a card (ASC/PYCARD), and caspase 1 (CASP1/CASP1)[16], thus resulting in the release of inflammatory cytokines including interleukin (IL)-1β (IL1B/IL1B)[16,17], IL-2, IL-4, IL-6, IL-13, and IL-18 (IL18) [17], and other inflammatory mediators, such as nitric oxide synthase, cycloxygenase-2, TNF-α [18], phospholipase-D, phospholipase A2, nuclear factor kappa-B (NF-kB)[19], and mitogen activated protein kinases. Since the P2RX7 signaling pathway regulates inflammation through the secretion of these cytokines and mediators, P2RX7 antagonists can be used in the treatment of inflammatory bowel disease [20]. In addition, the production of IL-1β was found to decrease in caspase1-deficient mice as well as in P2RX7-deficient mice [21-23]. Moreover, NLRP3 and CARD8 are susceptibility genes for the onset of CD [24]. The number of mast cells expressing P2RX7 have been reported to increase in the colon of CD patients and intestinal inflammation is inhibited by the treatment of anti-P2RX7 antibody [25].

  We therefore hypothesized that not only the activation of the TNFR signaling pathway, but also the activation of the P2RX7 signaling pathway may contribute to inflammation of the intestines in CD patients. The elevated production of inflammatory cytokines and mediators through the activation of the P2RX7 signaling pathway in the genetic background may lead to the perpetuation of the chronic intestinal inflammatory process and might thereby result in loss of response to IFX. Therefore, we examined an association study between polymorphisms of six target genes (P2RX7, CARD8, PYCARD, CASP1, IL1B, and IL18) involved in the P2RX7 signaling pathway and the therapeutic effect of IFX at the short, middle, or long period of treatment for Japanese CD patients. Another purpose of this study was to investigate whether the associated polymorphisms can be used as new genetic biomarkers for predicting either response or loss of response to IFX at each period by genetic testing.

Patients and methods

Patients

  In this study, 127 unrelated Japanese CD patients were enrolled and treated with IFX at three general hospitals, namely Oita Red Cross Hospital, Nagasaki Harbor Medical Center City Hospital, or Nagasaki University Hospital from 2004 to 2012.  

  The study protocol was approved by the Ethics Committee dealing with Human Genome and Gene Analysis at Oita Red Cross Hospital, Nagasaki Harbor Medical Center City Hospital, and Nagasaki University. Written informed consent was obtained from all patients.

Definition of the therapeutic effect of IFX: Since a higher Crohn’s disease activity index (CDAI) of more than 150 is regarded as active-phase CD patients [26], responders to IFX were defined as those showing a decrease in CDAI of less than 150 and an improvement in clinical manifestations, laboratory data, and/or endoscopic findings at each period of treatment. Non-responders to IFX were defined as those showing no change in the CDAI value or any exacerbation of the disease activity.

Study design

  All enrolled patients were analyzed after 10 weeks of treatment. Out of the 127 CD patients, 116 patients were subsequently analyzed after 1 year of treatment because they showed response to IFX after 10 weeks of treatment. Thus, 11 patients indicated primary non-response to IFX. Likewise, out of 116 patients, 97 patients, who had shown response to IFX after 1 year of treatment, were subjected to an analysis after 2 years of treatment. Therefore, 19 patients indicated secondary loss of response to IFX after 1 year of treatment. The clinical characteristics of the patients in each group at the end of this study are shown in Table 1.

Characteristics

Number (%) of CD patients

Responders

Non-responders

10 weeks (n = 127)

   

Number (%)

116 (91.3)

11 (8.7)

Age, mean ± SD (years)

35.2 ± 11.8

35.3 ± 11.8

Male/female (%)

67/49 (57.8/42.2)

10/1 (90.9/9.1)

1 year (n = 116)

 

 

Number (%)

97 (83.6)

19 (16.4)

Age, mean ± SD (years)

35.2 ± 11.9

35.6 ± 11.7

Male/female (%)

56/41 (57.7/42.3)

11/8 (57.9/42.1)

2 years (n = 97)

 

 

Number (%)

82 (84.5)

15 (15.5)

Age, mean ± SD (years)

35.1 ± 11.9

35.3 ± 11.8

Male/female (%)

48/34 (58.5/41.5)

8/7 (53.3/46.7)

Table 1. Comparison of the characteristics between responders and non-responders to IFX in CD patients. (IFX, infliximab; CD, Crohn's disease; SD, standard deviation).

Selection of tag SNPs in the candidate genes: The selected six candidate genes involved in the P2RX7 signaling pathway included P2RX7 (OMIM #602566) located at 12q24.31; CARD8 (OMIM #609051) located at 19q13.33; PYCARD (OMIM #606838) located at 16p11.2; CASP1 (OMIM #147678) located at 11q22.3; IL18 (OMIM #600953) located at 11q23.1, and IL1B (OMIM #147720) located at 2q14.1.

  Obtaining information on SNPs in the target genes, selecting the candidate tag SNPs, and determining the genotyped tag SNPs were carried out according to the same methods as reported previously [13,27,28]. The gene structures and positions of the genotyped tag SNPs in the candidate genes are shown in Figure 1.

Genotyping of tag SNPs in candidate genes: Genetic analyses for the genomic DNA extracted from each patient and genotyping of 35 tag SNPs in 6 genes by PCR-restriction fragment length polymorphism, PCR-direct DNA sequencing, or probe-based high resolution melting method were done according to the same method as reported previously [13,27,28]. Information on the sequences of primer sets, annealing temperature, cycle number, restriction enzymes, and genetic analytic methods for each SNP is shown in Table 2.

Gene

tag SNP

Major > Minor

Sequence of primer (5' to 3')

Annealing temperature (°C)

Cycle number

Analytic method (Restriction enzyme)

Forward

Reverse

P2RX7

rs684201

G > A

ATCTGATTTCCCCCACCAAC

GACTGGGAGCTTCCATTATGC

55

30

PCR-RFLP (BsrD I)

 

rs656612

A > C

GCAATTGCTGACCCCCTATT

CAACAGCTTGGTGGTCACAG

56

30

PCR-RFLP (Cac8 I)

 

rs11065450

C > A

GTGCCGGGTTCTGTTCTTAG

GCTTGGGTCTCCTGTTGTGT

57

50

PCR-HRM

 

rs1718125

G > A

GGCTGGTGCTCTTTGGTAGA

GGGTGAGATCCAGGAGATGA

57

30

PCR-RFLP (Bsh1236 I)

 

rs1186055

G > T

GAAGATCTGGGGGAAGGAAG

GCTTGGCACAAACTAGTATCTCTGG

56

50

PCR-HRM

 

rs208296

C > T

AGCCATTTTCCCAAGGACAC

GGGGGAAGGAAGTTTTCTCA

55

30

PCR-RFLP (Xsp I)

 

rs11065464

C > A

GGCAAGCAACTCCCTGAACT

GGCATTTACTGTGGCACCTC

58

30

PCR-RFLP (Mae III)

 

rs208307

G > C

TGGGACACTGTGGATTCTGA

AGGAGGCAGTGATCATTTGG

55

30

PCR-RFLP (HpyCH4 V)

 

rs7958311

G > A

AACGGTGATGTGTCCCAGAC

CCACTGGGTGAGTTTGACCT

57

30

PCR-RFLP (Fok I)

 

rs1653609

A > C

CACCCATAATTCCCCTACCC

AGAATTTTGAGTGGCTGTGG

54

30

PCR-RFLP (Mbo I)

 

rs3751143

T > G

TGTCTGGACAGGACCAGCTT

TTCCTGGACAACCAGAGGAG

59

30

PCR-RFLP (Hha I)

CARD8

rs1971783

T > C

CCAATAGCTTATATGCCCAGAAGG

CAGGTGAACACTCCAGCAAAT

55

30

PCR-RFLP (BsaA I)

 

rs4389238

C > T

AATAGGGTTCGCGCTCCTAC

TGCCCAGGAAGAAGGACATA

57

30

PCR-RFLP (Fau I)

 

rs4802448

G > A

ACAGGTGCTGTTGGGATACAG

TCCAGTCCTCAGCAAATGGT

57

50

PCR-HRM

 

rs4802449

G > A

ACTTGACCACACCTGGGAAG

GCTACCCGAATCCATAGCAA

57

30

PCR-RFLP (Dde I)

 

rs10418189

G > A

ACAGCGCATCCCAGATCAT

ACCTCAAGGGCATAGACTGCT

57

30

PCR-direct DNA sequencing

 

rs2043211

A > T

CCCCTGAGTTCGATGAAAAA

TAGGGGCCTGAGGAATGACT

53

30

PCR-RFLP (Mbo I)

 

rs16981845

T > C

CTCAGACTCCCATGACTCTTTCTT

TCACTAATGCCCTGCAATCC

55

30

PCR RFLP (Hsp92 II)

 

rs11670259

C > T

CCATGGGAGTTTTCCCTTCA

CCGAGACGGTGAGTGACTTT

56

50

PCR-HRM

rs12984929

G > T

CCAACCTGACAGAGGCAAAA

GAGGGTGGACACATACATTCG

56

30

PCR-RFLP (Hinc II)

rs11672725

C > T

CCCTGGCCCAGAGAAATAAT

CGCAGGCTGTGAGAAGCATA

56

50

PCR-HRM

rs6509368

G > A

TCAACCAGCTTATCTGAATGTTAGC

GTTGACCATGTTCCGCAAA

55

30

PCR-RFLP (Afa I)

rs1972619

G > A

TGGAAGCATTGTGTGTGTGTG

ACTGTGTTTGGGGAGCAGAC

56

30

PCR-RFLP (Hpy8 I)

PYCARD

rs8056505

T > C

AGGGGAGCCAGAATTTGATC

CCTCCACCACACACAGCTAT

56

30

PCR-RFLP (HpyCH4 IV)

CASP1

rs2282659

A > G

GGAGCGGGGTGAAACTAAAT

CCACAATGGGCTCTGTTTTT

54

30

PCR-RFLP (Ban II)

IL18

rs5744247

C > G

GAGAAAGAGGGCCACCAAAT

TGGCCTAGTACTGAACTGAATC

54

30

PCR-RFLP (Ple I)

 

rs2043055

A > G

CCTCCACCTGAAAGCCAAT

TCCTGGGAGGATCTTTCTGA

55

30

PCR-RFLP (Rsa I)

 

rs7106524

G > A

GTGGCTGAACTCACCACAGA

CTTTCAGGCCAGGTGCACTA

57

50

PCR-HRM

 

rs360717

C > G

CCATGGCTGACTTTCCAAAT

GCACAGAGCCCCAACTTTTA

54

30

PCR-RFLP (Aci I)

IL1B

rs1143643

G > A

AAAAGCCCCTGGAAACTAGG

CACATGATCAGGAGCCAGAC

54

50

PCR-HRM

rs1143633

A > G

TGTTCTTAGCCACCCCACTC

TCCATATCCTGTCCCTGGAG

56

30

PCR-RFLP (Fun4H I)

rs3136558

T > C

GGTGTCAGAAAGCCCACATT

GAGGAGGAAAGGGCTTGAAA

55

30

PCR-RFLP (Mbo I)

rs1143630

C > A

AGGTGGGGCATGTACAAAAA

AGATTATCCCTCTCTGAAGCTC

54

50

PCR-HRM

rs16944

G > A

GCCCTCCCTGTCTGTATTGA

AGGCACTTTGCTGGTGTCTC

56

30

PCR-RFLP (Ava I)

rs1143623

G > C

ATCAGAAGGCTGCTTGGAGA

AAACCTTGCTCCTCCTGGTT

56

30

PCR-RFLP (BseD I)

Table 2. Information on genotyping of tag SNPs in the candidate genes (SNP, single nucleotide polymorphism; 3'-UTR, 3'-untranslated region; PCR, polymerase chain reaction; RFLP, restriction fragment length polymorphism; HRM, high resolution melting).

Statistical analysis

  A comparison of the clinical characteristics, the significance of deviation from the Hardy-Weinberg equilibrium (HWE), and the frequencies of alleles and genotypes, subsequent multivariate regression analysis, and the statistical value of genetic tests were analyzed by the same methods as reported previously [13,27,28].

Results

Comparison of the clinical characteristics between responders and non-responders to IFX in each group

Comparison analyses of the clinical characteristics between responders and non-responders to IFX in each group revealed a significant difference in the gender after 10 weeks of treatment. The percentage of males in non-responders to IFX was higher than that in responders (90.9% vs. 57.8%, P = 0.049; Table 1), thereby indicating that male gender showed loss of response to IFX after 10 weeks of treatment. Conversely, females indicated response to IFX after 10 weeks of treatment. However, no significant differences in the mean age and gender were observed between responders and non-responders to IFX in other groups.

Association of tag SNPs with response to IFX after 10 weeks of treatment

The frequencies and distributions of minor alleles and genotypes at tag SNPs in each gene were identified and compared between responders and non-responders to IFX after 10 weeks of treatment (Table 3). The two tag SNPs, rs2043211 and rs1972619 in CARD8, were excluded from the subsequent analyses because they were not in HWE.

Gene

Tag SNP
(Major > Minor)

Genotype

Number (%) of CD patients

Inheritance model*

P value

OR

95% CI

Responders
(n = 116)

Non-responders
(n = 11)

P2RX7

rs684201

MAF

0.211

0.182

Allele

1.000

1.205

0.390-3.724

 

G > A

G/G

72 (62.1)

7 (63.6)

 

 

 

 

 

G/A

39 (33.6)

4 (36.4)

Dominant

1.000

1.069

0.296-3.864

 

 

A/A

5 (4.3)

0 (0)

Recessive

1.000

1.135

0.059-21.87

 

rs656612

MAF

0.306

0.409

Allele

0.320

0.637

0.260-1.558

 

A > C

A/A

52 (48.8)

3 (27.3)

 

 

 

 

 

A/C

57 (49.1)

7 (63.6)

Dominant

0.347

0.462

0.117-1.828

 

 

C/C

7 (6.0)

1 (9.1)

Recessive

0.526

0.642

0.072-5.757

 

rs11065450

MAF

0.332

0.409

Allele

0.465

0.718

0.294-1.752

 

C > A

C/C

51 (44.0)

3 (27.3)

 

 

 

 

 

C/A

53 (45.7)

7 (63.6)

Dominant

0.352

0.478

0.121-1.894

 

 

A/A

12 (10.3)

1 (9.1)

Recessive

1.000

1.154

0.136-9.814

 

rs1718125

MAF

0.263

0.273

Allele

0.921

0.951

0.356-2.541

 

G > A

G/G

63 (54.3)

5 (45.5)

 

 

 

 

 

G/A

45 (38.8)

6 (54.5)

Dominant

0.754

0.701

0.203-2.427

 

 

A/A

8 (6.9)

0 (0)

Recessive

1.000

1.802

0.097-33.31

 

rs1186055

MAF

0.392

0.590

Allele

0.070

0.447

0.184-1.088

 

G > T

G/G

42 (36.2)

1 (9.1)

 

 

 

 

 

G/T

57 (49.1)

7 (63.6)

Dominant

0.097

0.176

0.022-1.425

 

 

T/T

17 (14.7)

3 (27.3)

Recessive

0.378

0.458

0.110-1.900

 

rs208296

MAF

0.319

0.318

Allele

0.994

1.004

0.393-2.566

 

C > T

C/C

51 (44.0)

4 (36.4)

 

 

 

 

 

C/T

56 (48.3)

7 (63.6)

Dominant

0.756

0.728

0.202-2.625

 

 

T/T

9 (7.8)

0 (0.0)

Recessive

1.000

2.033

0.111-37.27

 

rs11065464

MAF

0.237

0.045

Allele

0.055

6.527

0.858-49.51

 

C > A

C/C

67 (57.8)

10 (90.9)

 

 

 

 

 

C/A

43 (37.1)

1 (9.1)

Dominant

0.049

7.315

0.906-59.17

 

 

A/A

6 (5.2)

0 (0.0)

Recessive

1.000

1.353

0.071-25.61

 

rs208307

MAF

0.147

0.318

Allele

0.205

0.536

0.201-1.425

 

G > C

G/G

86 (74.1)

6 (54.5)

 

 

 

 

 

G/C

26 (22.4)

3 (27.3)

Dominant

0.174

0.419

0.119-1.472

 

 

C/C

4 (3.4)

2 (18.2)

Recessive

0.085

0.161

0.026-1.000

 

rs7958311

MAF

0.349

0.182

Allele

0.156

2.414

0.790-7.375

 

G > A

G/G

53 (45.7)

8 (72.7)

 

 

 

 

 

G/A

45 (38.8)

2 (18.2)

Dominant

0.117

3.170

0.800-12.55

 

 

A/A

18 (15.5)

1 (9.1)

Recessive

1.000

1.837

0.221-15.24

 

rs1653609

MAF

0.280

0.364

Allele

0.408

0.681

0.273-1.700

 

A > C

A/A

59 (50.9)

4 (36.4)

 

 

 

 

 

A/C

49 (42.2)

6 (54.5)

Dominant

0.530

0.552

0.153-1.988

 

 

C/C

8 (6.9)

1 (9.1)

Recessive

0.570

0.741

0.084-6.536

 

rs3751143

MAF

0.319

0.455

Allele

0.196

0.562

0.232-1.361

 

T > G

T/T

54 (46.6)

2 (27.3)

 

 

 

 

 

T/G

50 (43.1)

6 (54.5)

Dominant

0.343

0.431

0.109-1.705

 

G/G

12 (10.3)

2 (18.2)

Recessive

0.348

0.519

0.100-2.689

CARD8

rs1971783

MAF

0.478

0.455

Allele

0.830

1.101

0.458-2.648

 

T > C

T/T

28 (24.1)

3 (27.3)

 

 

 

 

 

T/C

65 (56.0)

6 (54.5)

Dominant

0.729

1.179

0.293-4.748

 

 

C/C

23 (19.8)

2 (18.2)

Recessive

1.000

1.113

0.225-5.507

 

rs4389238

MAF

0.297

0.182

Allele

0.328

1.905

0.622-5.834

 

C > T

C/C

56 (48.3)

7 (63.6)

 

 

 

 

 

C/T

51 (44.0)

4 (36.4)

Dominant

0.364

1.875

0.521-6.752

 

 

T/T

9 (7.8)

0 (0)

Recessive

1.000

2.033

0.111-37.03

 

rs4802448

MAF

0.310

0.227

Allele

0.478

1.530

0.543-4.308

 

G > A

G/G

58 (50.0)

7 (63.6)

 

 

 

 

 

G/A

44 (37.9)

3 (27.3)

Dominant

0.531

1.750

0.486-6.301

 

 

A/A

14 (12.1)

1 (9.1)

Recessive

1.000

1.372

0.163-11.55

 

rs4802449

MAF

0.220

0.455

Allele

0.014

0.338

0.138-0.827

 

G > A

G/G

70 (60.3)

3 (27.3)

 

 

 

 

 

G/A

41 (35.3)

6 (54.5)

Dominant

0.053

0.246

0.062-0.978

 

 

A/A

5 (4.3)

2 (18.2)

Recessive

0.113

0.203

0.034-1.196

 

rs10418189

MAF

0.474

0.318

Allele

0.161

1.932

0.760-4.914

 

G > A

G/G

31 (26.7)

5 (45.5)

 

 

 

 

 

G/A

60 (51.7)

5 (45.5)

Dominant

0.291

2.285

0.651-8.026

 

 

A/A

25 (21.6)

1 (9.1)

Recessive

0.459

2.747

0.335-22.47

rs16981845

MAF

0.034

0.136

Allele

0.001

0.032

0.007-0.130

T > C

T/T

108 (93.1)

8 (72.7)

 

 

 

 

T/C

8 (6.9)

3 (27.3)

Dominant

0.055

0.198

0.044-0.894

 

C/C

0 (0)

0 (0)

Recessive

-

-

-

rs11670259

MAF

0.172

0.364

Allele

0.029

0.365

0.143-0.927

C > T

C/C

79 (68.1)

4 (36.4)

 

 

 

 

C/T

34 (29.3)

6 (54.5)

Dominant

0.047

0.268

0.074-0.971

 

T/T

3 (2.6)

1 (9.1)

Recessive

0.307

0.265

0.025-2.794

rs12984929

MAF

0.349

0.500

Allele

0.159

0.536

0.223-1.291

G > T

G/G

52 (44.8)

2 (18.2)

 

 

 

 

G/T

47 (40.5)

7 (63.6)

Dominant

0.115

0.274

0.057-1.322

 

T/T

17 (14.7)

2 (18.2)

Recessive

0.669

0.773

0.153-3.890

rs11672725

MAF

0.190

0.318

Allele

0.150

0.502

0.193-1.304

C > T

C/C

74 (63.8)

5 (45.5)

 

 

 

 

C/T

40 (34.5)

5 (45.5)

Dominant

0.330

0.473

0.136-1.644

 

T/T

2 (1.7)

1 (9.1)

Recessive

0.240

0.175

0.015-2.107

rs6509368

MAF

0.388

0.273

Allele

0.287

1.690

0.638-4.480

G > A

G/G

47 (40.5)

5 (45.5)

 

 

 

 

G/A

48 (41.4)

6 (54.5)

Dominant

0.758

1.223

0.353-4.243

A/A

21 (18.1)

0 (0)

Recessive

0.209

5.178

0.293-91.37

PYCARD

rs8056505

MAF

0.159

0.136

Allele

1.000

1.202

0.338-4.268

 

T > C

T/T

82 (70.2)

8 (72.7)

 

 

 

 

 

T/C

31 (26.7)

3 (27.3)

Dominant

1.000

1.106

0.277-4.421

 

C/C

3 (2.6)

0 (0)

Recessive

1.000

0.709

0.034-14.61

CASP1

rs2282659

MAF

0.273

0.364

Allele

0.358

0.652

0.261-1.630

 

A > G

A/A

59 (50.9)

3 (27.3)

 

 

 

 

 

A/G

51 (44.0)

8 (72.7)

Dominant

0.207

0.362

0.092-1.434

 

G/G

6 (5.2)

0 (0)

Recessive

1.000

1.353

0.070-25.61

IL18

rs5744247

MAF

0.440

0.364

Allele

0.492

1.373

0.555-3.399

 

C > G

C/C

34 (29.3)

6 (54.5)

 

 

 

 

 

C/G

62 (53.4)

2 (18.2)

Dominant

0.099

2.894

0.827-10.12

 

G/G

20 (17.2)

3 (27.3)

Recessive

0.418

0.556

0.135-2.279

 

rs2043055

MAF

0.414

0.364

Allele

0.648

1.235

0.499-3.060

 

A > G

A/A

39 (33.6)

5 (45.5)

 

 

 

 

 

A/G

58 (50.0)

4 (36.4)

Dominant

0.512

1.645

0.472-5.731

 

G/G

19 (16.4)

2 (18.2)

Recessive

1.000

0.881

0.176-4.405

 

rs7106524

MAF

0.414

0.364

Allele

0.648

1.235

0.499-3.060

 

G > A

G/G

38 (32.8)

4 (36.4)

 

 

 

 

 

G/A

60 (51.7)

6 (54.5)

Dominant

0.752

1.173

0.323-4.254

 

A/A

18 (15.5)

1 (9.1)

Recessive

1.000

1.837

0.221-15.24

 

rs360717

MAF

0.121

0.227

Allele

0.179

0.467

0.160-1.364

 

C > G

C/C

89 (76.7)

6 (54.5)

 

 

 

 

 

C/G

26 (22.4)

5 (45.5)

Dominant

0.143

0.364

0.103-1.287

 

G/G

1 (0.9)

0 (0)

Recessive

1.000

0.299

0.011-7.768

IL1B

rs1143643

MAF

0.422

0.545

Allele

0.266

0.609

0.253-1.468

 

G > A

G/G

38 (32.8)

1 (9.1)

 

 

 

 

 

G/A

58 (50.0)

8 (72.7)

Dominant

0.171

0.205

0.025-1.663

 

A/A

20 (17.2)

2 (18.2)

Recessive

1.000

0.937

0.188-4.673

 

rs1143633

MAF

0.405

0.545

Allele

0.202

0.568

0.236-1.367

 

A > G

A/A

38 (32.8)

2 (18.2)

 

 

 

 

 

A/G

62 (53.4)

6 (54.5)

Dominant

0.500

0.456

0.094-2.216

 

G/G

16 (13.8)

3 (27.3)

Recessive

0.213

0.427

0.102-1.779

 

rs3136558

MAF

0.491

0.364

Allele

0.252

1.691

0.683-4.184

 

T > C

T/T

27 (23.3)

4 (36.4)

 

 

 

 

 

T/C

64 (55.2)

6 (54.5)

Dominant

0.461

1.884

0.512-6.925

 

C/C

25 (21.6)

1 (9.1)

Recessive

0.459

2.747

0.335-22.47

 

rs1143630

MAF

0.151

0.273

Allele

0.138

0.474

0.173-1.294

 

C > A

C/C

84 (72.4)

7 (63.6)

 

 

 

 

 

C/A

29 (25.0)

2 (18.2)

Dominant

0.505

0.667

0.183-2.432

 

 

A/A

3 (2.6)

2 (18.2)

Recessive

0.059

0.119

0.018-0.810

rs16944

MAF

0.427

0.682

Allele

0.022

0.347

0.136-0.884

G > A

G/G

38 (32.8)

0 (0)

 

 

 

 

G/A

57 (49.1)

7 (63.6)

Dominant

0.033

0.089

0.005-1.545

A/A

21 (18.1)

4 (36.4)

Recessive

0.225

0.387

0.104-1.443

 

rs1143623

MAF

0.336

0.636

Allele

0.005

0.289

0.116-0.719

G > C

G/G

52 (44.8)

1 (9.1)

 

 

 

 

G/C

50 (43.1)

6 (54.5)

Dominant

0.025

0.123

0.015-0.993

C/C

14 (12.1)

4 (36.4)

Recessive

0.050

0.240

0.062-0.926

Table 3. Allele and genotype comparisons in three inheritance models between responders and non-responders to IFX after 10 weeks of treatment for CD patients.

*Allele: allele model; Dominant: the minor allele dominant model; Recessive: the minor allele recessive model.( IFX, infliximab; CD, Crohn's disease; SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval; MAF, minor allele frequency).

  The frequencies of a heterozygous C/T genotype and a minor homozygous T/T genotype of rs11670259 in CARD8 in the minor allele dominant model were significantly decreased in responders in comparison to those in non-responders (31.9% vs. 63.6%, P = 0.047, OR = 0.268; Table 3), thereby indicating ~3.7-fold loss of response to IFX after 10 weeks of treatment. Conversely, the possession of a major homozygous C/C genotype of rs11670259 in CARD8 indicated ~3.7-fold response to IFX.

  Moreover, the frequencies of a heterozygous G/C genotype and a minor homozygous C/C genotype of rs1143623 in IL1B in the minor allele dominant model were significantly decreased in responders in comparison to those in non-responders (55.2% vs. 90.9%, P = 0.025, OR = 0.123; Tables 3), indicating that this genotype is associated with ~8.1-fold loss of response to IFX. Conversely, the possession of a major homozygous G/G genotype of rs1143623 in IL1B indicated ~8.1-fold response to IFX after 10 weeks of treatment.

  There were no significant differences in the frequencies of any other alleles and genotypes at tag SNPs between responders and non-responders after 10 weeks of treatment.

Association of tag SNPs with response to IFX after 1 year of treatment

The frequencies and distributions of minor alleles and genotypes at tag SNPs in each gene were identified and compared between responders and non-responders to IFX after 1 year of treatment (Table 4).

Gene

Tag SNP
(Major > Minor)

Genotype

Number (%) of CD patients

Inheritance model*

P value

OR

95% CI

Responders
(n = 97)

Non-responders
(n = 19)

P2RX7

rs684201

MAF

0.222

0.158

Allele

0.379

1.519

0.596-3.870

 

G > A

G/G

59 (60.8)

13 (68.4)

 

 

 

 

 

 

G/A

33 (34.0)

6 (31.6)

Dominant

0.533

1.395

0.488-3.987

 

 

A/A

5 (5.2)

0 (0)

Recessive

0.590

2.319

0.123-43.72

 

rs656612

MAF

0.320

0.237

Allele

0.312

1.514

0.676-3.390

 

A > C

A/A

41 (42.3)

11 (57.9)

 

 

 

 

 

 

A/C

50 (51.5)

7 (36.8)

Dominant

0.210

1.878

0.694-5.084

 

 

C/C

6 (6.2)

1 (5.3)

Recessive

1.000

1.187

0.135-10.46

 

rs11065450

MAF

0.361

0.184

Allele

0.035

2.500

1.046-5.974

 

C > A

C/C

39 (40.2)

12 (63.2)

 

 

 

 

 

 

C/A

46 (47.4)

7 (36.8)

Dominant

0.065

2.550

0.922-7.047

 

 

A/A

12 (12.4)

0 (0)

Recessive

0.211

5.702

0.323-100.6

 

rs1718125

MAF

0.273

0.211

Allele

0.422

1.410

0.608-3.270

 

G > A

G/G

51 (52.6)

12 (63.2)

 

 

 

 

 

 

G/A

39 (40.2)

6 (31.6)

Dominant

0.397

1.546

0.561-4.261

 

 

A/A

7 (7.2)

1 (5.3)

Recessive

1.000

1.400

0.162-12.09

 

rs1186055

MAF

0.392

0.395

Allele

0.973

0.988

0.485-2.012

 

G > T

G/G

36 (37.1)

6 (31.6)

 

 

 

 

 

 

G/T

46 (47.4)

11 (57.9)

Dominant

0.646

0.782

0.273-2.238

 

 

T/T

15 (15.5)

2 (10.5)

Recessive

0.735

1.555

0.325-7.435

 

rs208296

MAF

0.340

0.211

Allele

0.117

1.933

0.839-4.454

 

C > T

C/C

40 (41.2)

11 (57.9)

 

 

 

 

 

 

C/T

48 (49.5)

8 (42.1)

Dominant

0.181

1.959

 0.723-5.308

 

 

T/T

9 (9.3)

0 (0)

Recessive

0.352

4.186

 0.234-75.06

 

rs11065464

MAF

0.247

0.184

Allele

0.402

1.456

 0.602-3.520

 

C > A

C/C

54 (55.7)

13 (68.4)

 

 

 

 

 

 

C/A

38 (39.2)

5 (26.3)

Dominant

0.304

1.725

 0.606-4.916

 

 

A/A

5 (5.2)

1 (5.3)

Recessive

1.000

0.978

 0.108-8.881

 

rs208307

MAF

0.155

0.105

Allele

0.616

1.555

 0.514-4.704

 

G > C

G/G

70 (72.2)

16 (84.2)

 

 

 

 

 

 

G/C

24 (24.7)

2 (10.5)

Dominant

0.393

2.057

 0.555-7.628

 

 

C/C

3 (3.1)

1 (5.3)

Recessive

0.516

0.574

 0.057-5.838

 

rs7958311

MAF

0.361

0.289

Allele

0.399

1.386

 0.648-2.962

 

G > A

G/G

41 (42.3)

12 (63.2)

 

 

 

 

 

 

G/A

42 (43.3)

3 (15.8)

Dominant

0.095

2.341

 0.848-6.464

 

 

A/A

14 (14.4)

4 (21.1)

Recessive

0.492

0.633

 0.183-2.185

 

rs1653609

MAF

0.294

0.211

Allele

0.296

1.560

 0.674-3.610

 

A > C

A/A

46 (47.4)

13 (68.4)

 

 

 

 

 

 

A/C

45 (46.4)

4 (21.1)

Dominant

0.094

2.402

 0.844-6.840

 

 

C/C

6 (6.2)

2 (10.5)

Recessive

0.616

0.560

 0.104-3.013

 

rs3751143

MAF

0.289

0.474

Allele

0.025

0.451

0.222-0.916

 

T > G

T/T

47 (48.5)

7 (36.8)

 

 

 

 

 

 

T/G

44 (45.5)

6 (31.6)

Dominant

0.354

0.621

 0.225-1.710

 

G/G

6 (6.2)

6 (31.6)

Recessive

0.001

0.143

 0.040-0.510

CARD8

rs1971783

MAF

0.490

0.421

Allele

0.439

1.319

 0.653-2.665

 

T > C

T/T

21 (21.6)

7 (36.8)

 

 

 

 

 

 

T/C

57 (58.8)

8 (42.1)

Dominant

0.157

2.111

 0.739-6.031

 

 

C/C

19 (19.6)

4 (21.1)

Recessive

1.000

0.913

 0.272-3.068

 

rs4389238

MAF

0.268

0.447

Allele

0.027

0.452

 0.222-0.924

 

C > T

C/C

52 (53.6)

4 (21.1)

 

 

 

 

 

 

C/T

38 (39.2)

13 (68.4)

Dominant

0.012

0.231

 0.071-0.746

 

 

T/T

7 (7.2)

2 (10.5)

Recessive

0.640

0.661

 0.126-3.459

 

rs4802448

MAF

0.309

0.316

Allele

0.937

0.970

 0.459-2.051

 

G > A

G/G

48 (49.5)

10 (52.6)

 

 

 

 

 

 

G/A

38 (39.2)

6 (31.6)

Dominant

0.802

1.134

 0.424-3.036

 

 

A/A

11 (11.3)

3 (15.8)

Recessive

0.699

0.682

 0.171-2.722

 

rs4802449

MAF

0.216

0.237

Allele

0.782

0.890

 0.391-2.026

 

G > A

G/G

60 (61.9)

10 (52.6)

 

 

 

 

 

 

G/A

32 (33.0)

9 (47.4)

Dominant

0.452

0.685

 0.255-1.843

 

 

A/A

5 (5.2)

0 (0)

Recessive

0.590

2.319

 0.123-43.72

 

rs10418189

MAF

0.479

0.447

Allele

0.718

1.137

 0.566-2.288

 

G > A

G/G

25 (25.8)

6 (31.6)

 

 

 

 

 

 

G/A

51 (52.6)

9 (47.4)

Dominant

0.601

1.329

 0.456-3.871

 

 

A/A

21 (21.6)

4 (21.1)

Recessive

1.000

1.036

 0.311-3.454

 

rs16981845

MAF

0.036

0.026

Allele

1.000

1.385

0.165-11.49

 

T > C

T/T

90 (92.8)

18 (94.7)

 

 

 

 

 

 

T/C

7 (7.2)

1 (5.3)

Dominant

1.000

0.714

 0.083-6.169

 

 

C/C

0 (0)

0 (0)

Recessive

-

-

-

 

rs11670259

MAF

0.170

0.184

Allele

0.833

0.908

 0.368-2.236

 

C > T

C/C

67 (69.1)

12 (63.2)

 

 

 

 

 

 

C/T

27 (27.8)

7 (36.8)

Dominant

0.613

0.768

 0.275-2.143

 

 

T/T

3 (3.1)

0 (0)

Recessive

1.000

1.444

 0.071-29.41

 

rs12984929

MAF

0.351

0.342

Allele

0.921

1.038

 0.499-2.158

 

G > T

G/G

44 (45.4)

8 (42.1)

 

 

 

 

 

 

G/T

38 (39.2)

9 (47.4)

Dominant

0.794

0.876

 0.324-2.369

 

 

T/T

15 (15.5)

2 (10.5)

Recessive

0.735

1.555

 0.325-7.435

 

rs11672725

MAF

0.186

0.211

Allele

0.720

0.854

 0.362-2.019

 

C > T

C/C

63 (64.9)

11 (57.9)

 

 

 

 

 

 

C/T

32 (33.0)

8 (42.1)

Dominant

0.559

0.742

 0.273-2.021

 

 

T/T

2 (2.1)

0 (0)

Recessive

1.000

1.021

 0.047-22.22

 

rs6509368

MAF

0.376

0.447

Allele

0.411

0.745

 0.369-1.504

 

G > A

G/G

41 (42.3)

6 (31.6)

 

 

 

 

 

 

G/A

49 (40.2)

9 (47.4)

Dominant

0.386

0.630

 0.221-1.798

 

A/A

17 (17.5)

4 (21.1)

Recessive

0.747

0.797

 0.235-2.701

PYCARD

rs8056505

MAF

0.165

0.132

Allele

0.809

1.304

 0.473-3.595

 

T > C

T/T

68 (70.1)

14 (73.7)

 

 

 

 

 

 

T/C

26 (26.8)

5 (26.3)

Dominant

1.000

1.194

 0.394-3.623

 

C/C

3 (3.1)

0 (0)

Recessive

1.000

1.444

 0.072-29.12

CASP1

rs2282659

MAF

0.309

0.079

Allele

0.003

5.225

 1.546-17.67

 

A > G

A/A

43 (44.3)

16 (84.2)

 

 

 

 

 

 

A/G

48 (49.5)

3 (15.8)

Dominant

0.002

6.698

 1.832-24.51

 

G/G

6 (6.2)

0 (0)

Recessive

0.587

2.770

 0.150-51.29

IL18

rs5744247

MAF

0.443

0.421

Allele

0.801

1.095

 0.542-2.213

 

C > G

C/C

29 (29.9)

5 (26.3)

 

 

 

 

 

 

C/G

50 (51.5)

12 (63.2)

Dominant

1.000

0.837

 0.276-2.541

 

G/G

18 (18.6)

2 (10.5)

Recessive

0.521

1.937

 0.410-9.141

 

rs2043055

MAF

0.407

0.447

Allele

0.646

0.849

 0.421-1.710

 

A > G

A/A

35 (36.1)

4 (21.1)

 

 

 

 

 

 

A/G

45 (46.4)

13 (68.4)

Dominant

0.290

0.472

 0.145-1.535

 

G/G

17 (17.5)

2 (10.5)

Recessive

0.735

1.806

 0.381-8.562

 

rs7106524

MAF

0.402

0.474

Allele

0.412

0.747

 0.372-1.502

 

G > A

G/G

34 (35.1)

4 (21.1)

 

 

 

 

 

 

G/A

48 (49.1)

12 (63.2)

Dominant

0.293

0.494

 0.152-1.607

 

A/A

15 (15.5)

3 (15.8)

Recessive

1.000

0.976

 0.253-3.765

 

rs360717

MAF

0.119

0.132

Allele

0.788

0.888

 0.315-2.503

 

C > G

C/C

75 (77.3)

14 (73.7)

 

 

 

 

 

 

C/G

21 (21.6)

5 (26.3)

Dominant

0.769

0.821

 0.266-2.533

 

G/G

1 (1.0)

0 (0)

Recessive

1.000

0.606

 0.024-15.45

IL1B

rs1143643

MAF

0.428

0.395

Allele

0.706

1.147

0.564-2.331

 

G > A

G/G

31 (32.0)

7 (36.8)

 

 

 

 

 

 

G/A

49 (50.5)

9 (47.4)

Dominant

0.678

1.242

 0.446-3.463

 

A/A

17 (17.5)

3 (15.8)

Recessive

1.000

1.133

 0.297-4.327

 

rs1143633

MAF

0.421

0.368

Allele

0.614

1.203

 0.586-2.468

 

A > G

A/A

31 (32.0)

7 (36.8)

 

 

 

 

 

 

A/G

52 (53.6)

10 (52.6)

Dominant

0.678

1.242

 0.446-3.463

 

G/G

14 (14.4)

2 (10.5)

Recessive

1.000

1.434

 0.298-6.897

 

rs3136558

MAF

0.469

0.605

Allele

0.125

0.576

 0.284-1.171

 

T > C

T/T

25 (25.8)

2 (10.5)

 

 

 

 

 

 

T/C

53 (54.6)

11 (57.9)

Dominant

0.235

0.339

 0.073-1.571

 

C/C

19 (19.6)

6 (31.6)

Recessive

0.245

0.528

 0.178-1.569

 

rs1143630

MAF

0.144

0.184

Allele

0.530

0.747

 0.300-1.861

 

C > A

C/C

72 (74.2)

12 (63.2)

 

 

 

 

 

 

C/A

22 (22.7)

7 (36.8)

Dominant

0.324

0.595

 0.211-1.680

 

 

A/A

3 (3.1)

0 (0)

Recessive

1.000

1.444

 0.072-29.12

 

rs16944

MAF

0.448

0.316

Allele

0.131

1.762

 0.840-3.693

 

G > A

G/G

30 (30.9)

8 (42.1)

 

 

 

 

 

 

G/A

47 (48.5)

10 (52.6)

Dominant

0.343

1.624

 0.593-4.448

 

A/A

20 (20.6)

1 (5.3)

Recessive

0.190

4.675

 0.588-37.18

rs1143623

MAF

0.351

0.263

Allele

0.297

1.511

 0.693-3.296

G > C

G/G

42 (43.3)

10 (52.6)

 

 

 

 

 

G/C

42 (43.3)

8 (42.1)

Dominant

0.455

1.455

 0.543-3.900

C/C

13 (13.4)

1 (5.3)

Recessive

0.461

2.786

 0.342-22.68

Table 4. Allele and genotype comparisons in three inheritance models between responders and non-responders to IFX after 1 year of treatment for CD patients.

* Allele: allele model; Dominant: the minor allele dominant model; Recessive: the minor allele recessive model. (IFX, infliximab; CD, Crohn's disease; SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval; MAF, minor allele frequency).

  With regard to rs3751143 in P2RX7, the frequency of a minor homozygous G/G genotype in the minor allele recessive model were significantly lower in responders in comparison to those in non-responders (6.2% vs. 31.6%, P = 0.001, OR = 0.143; Table 4). This result implied that ~7.0-fold loss of response to IFX after 1 year of treatment. Conversely, the possession of a major homozygous T/T genotype or a heterozygous T/G genotype of rs3751143 indicated ~7.0-fold response to IFX.

  Moreover, the frequencies of a heterozygous C/T genotype and a minor homozygous T/T genotype of rs4389238 in CARD8 in the minor allele dominant model were significantly decreased in responders in comparison to those in non-responders (46.4% vs. 78.9%, P = 0.012, OR = 0.231; Tables 4), indicating that these genotypes are associated with ~4.3-fold loss of response to IFX. Conversely, the possession of a major homozygous C/C genotype of rs4389238 in CARD8 indicated ~4.3-fold response to IFX after 1 year of treatment.

  In addition, the frequencies of a heterozygous A/G genotype and a minor homozygous G/G genotype of rs2282659 in CASP1 in the minor allele dominant model were significantly increased in responders in comparison to those in non-responders (55.7% vs. 15.8%, P = 0.002, OR = 6.698; Tables 4), indicating that these genotypes are associated with ~6.7-fold response to IFX. Conversely, possessing a major homozygous A/A genotype of rs2282659 in CASP1 indicated ~6.7-fold loss of response to IFX after 1 year of treatment.

  There were no significant differences in the frequencies of any other alleles and genotypes at tag SNPs between responders and non-responders after 1 year of treatment.

Association of tag SNPs with response to IFX after 2 years of treatment

The frequencies and distributions of minor alleles and genotypes at tag SNPs in each gene were identified and compared between responders and non-responders to IFX after 2 years of treatment (Table 5).

Gene

Tag SNP
(Major > Minor)

Genotype

Number (%) of CD patients

Inheritance model*

P value

OR

95% CI

Responders
(n = 82)

Non-responders
(n = 15)

P2RX7

rs684201

MAF

0.244

0.100

Allele

0.096

2.904

 0.836-10.08

 

G > A

G/G

47 (57.3)

12 (80.0)

 

 

 

 

 

 

G/A

30 (36.6)

3 (20.0)

Dominant

0.150

2.979

 0.781-11.36

 

 

A/A

5 (6.1)

0 (0)

Recessive

1.000

2.200

 0.116-41.89

 

rs656612

MAF

0.317

0.333

Allele

0.861

0.929

 0.406-2.124

 

A > C

A/A

36 (43.9)

5 (33.3)

 

 

 

 

 

 

A/C

40 (48.8)

10 (66.7)

Dominant

0.574

0.639

 0.201-2.035

 

 

C/C

6 (7.3)

0 (0)

Recessive

0.586

2.634

 0.141-49.26

 

rs11065450

MAF

0.372

0.300

Allele

0.451

1.382

 0.595-3.209

 

C > A

C/C

33 (40.2)

6 (40.0)

 

 

 

 

 

 

C/A

37 (45.1)

9 (60.0)

Dominant

0.986

0.990

 0.322-3.044

 

 

A/A

12 (14.6)

0 (0)

Recessive

0.203

5.496

 0.308-97.95

 

rs1718125

MAF

0.299

0.133

Allele

0.075

2.769

 0.918-8.361

 

G > A

G/G

40 (48.8)

11 (73.3)

 

 

 

 

 

 

G/A

35 (42.7)

4 (26.7)

Dominant

0.097

2.888

 0.849-9.814

 

 

A/A

7 (8.5)

0 (0)

Recessive

0.591

3.079

 0.167-56.82

 

rs1186055

MAF

0.396

0.367

Allele

0.760

1.134

 0.507-2.539

 

G > T

G/G

31 (37.8)

5 (33.3)

 

 

 

 

 

 

G/T

37 (45.1)

9 (60.0)

Dominant

1.000

0.823

 0.257-2.631

 

 

T/T

14 (17.1)

1 (6.7)

Recessive

0.454

2.883

 0.350-23.75

 

rs208296

MAF

0.335

0.367

Allele

0.739

0.872

 0.388-1.960

 

C > T

C/C

35 (42.7)

5 (33.3)

 

 

 

 

 

 

C/T

39 (47.6)

9 (60.0)

Dominant

0.578

0.671

 0.211-2.140

 

 

T/T

8 (9.8)

1 (6.7)

Recessive

1.000

1.514

 0.175-13.07

 

rs11065464

MAF

0.256

0.200

Allele

0.513

1.377

 0.527-3.600

 

C > A

C/C

44 (53.7)

10 (66.7)

 

 

 

 

 

 

C/A

34 (41.5)

4 (26.7)

Dominant

0.408

1.727

 0.543-5.498

 

 

A/A

4 (4.9)

1 (6.7)

Recessive

0.577

0.718

 0.075-6.906

 

rs208307

MAF

0.140

0.233

Allele

0.195

0.536

 0.206-1.391

 

G > C

G/G

62 (75.6)

8 (53.3)

 

 

 

 

 

 

G/C

17 (20.7)

7 (46.7)

Dominant

0.077

0.369

 0.119-1.144

 

 

C/C

3 (3.7)

0 (0)

Recessive

1.000

1.365

 0.067-27.78

 

rs7958311

MAF

0.366

0.333

Allele

0.733

1.154

 0.507-2.627

 

G > A

G/G

34 (41.5)

7 (46.7)

 

 

 

 

 

 

G/A

36 (43.9)

6 (40.0)

Dominant

0.708

1.235

 0.409-3.731

 

 

A/A

12 (14.6)

2 (13.3)

Recessive

1.000

1.114

 0.223-5.574

 

rs1653609

MAF

0.293

0.300

Allele

0.936

0.966

 0.413-2.259

 

A > C

A/A

40 (48.8)

6 (40.0)

 

 

 

 

 

 

A/C

36 (43.9)

9 (60.0)

Dominant

0.531

0.700

 0.228-2.145

 

 

C/C

6 (7.3)

0 (0)

Recessive

0.586

2.634

 0.141-49.26

 

rs3751143

MAF

0.262

0.433

Allele

0.057

0.465

0.209-1.036

 

T > G

T/T

43 (52.4)

4 (26.7)

 

 

 

 

 

 

T/G

35 (42.7)

9 (60.0)

Dominant

0.092

0.330

 0.097-1.121

 

G/G

4 (4.9)

2 (13.3)

Recessive

0.232

0.333

 0.055-2.009

CARD8

rs1971783

MAF

0.512

0.367

Allele

0.143

1.814

 0.812-4.049

 

T > C

T/T

17 (20.7)

4 (26.7)

 

 

 

 

 

 

T/C

46 (56.1)

11 (73.3)

Dominant

0.733

1.390

 0.393-4.916

 

 

C/C

19 (23.2)

0 (0)

Recessive

0.037

0.105

 0.006-1.838

 

rs4389238

MAF

0.274

0.233

Allele

0.641

1.243

 0.499-3.096

 

C > T

C/C

43 (52.4)

9 (60.0)

 

 

 

 

 

 

C/T

33 (40.2)

5 (33.3)

Dominant

0.589

1.361

 0.444-4.170

 

 

T/T

6 (7.3)

1 (6.7)

Recessive

1.000

1.105

 0.123-9.901

 

rs4802448

MAF

0.299

0.367

Allele

0.460

0.736

 0.326-1.662

 

G > A

G/G

41 (50.0)

7 (46.7)

 

 

 

 

 

 

G/A

33 (40.2)

5 (33.3)

Dominant

0.812

0.875

 0.290-2.636

 

 

A/A

8 (9.8)

3 (20.0)

Recessive

0.368

0.432

 0.100-1.863

 

rs4802449

MAF

0.201

0.300

Allele

0.227

0.588

 0.246-1.402

 

G > A

G/G

52 (63.4)

8 (53.3)

 

 

 

 

 

 

G/A

27 (32.9)

5 (33.3)

Dominant

0.460

0.659

 0.217-2.000

 

 

A/A

3 (3.7)

2 (13.3)

Recessive

0.170

0.247

 0.038-1.622

 

rs10418189

MAF

0.506

0.333

Allele

0.082

2.049

 0.904-4.647

 

G > A

G/G

20 (24.4)

5 (33.3)

 

 

 

 

 

 

G/A

41 (50.0)

10 (66.7)

Dominant

0.525

1.550

 0.473-5.074

 

 

A/A

21 (25.6)

0 (0)

Recessive

0.036

10.840

 0.621-189.0

rs16981845

MAF

0.037

0.033

Allele

1.000

1.101

0.128-9.524

T > C

T/T

76 (92.7)

14 (93.3)

 

 

 

 

 

T/C

6 (7.3)

1 (6.7)

Dominant

1.000

0.905

 0.101-8.108

 

C/C

0 (0)

0 (0)

Recessive

-

-

-

rs11670259

MAF

0.152

0.267

Allele

0.126

0.495

 0.198-1.234

C > T

C/C

59 (72.0)

8 (53.3)

 

 

 

 

 

C/T

21 (25.6)

6 (40.0)

Dominant

0.152

0.446

 0.145-1.369

 

T/T

2 (2.4)

1 (6.7)

Recessive

0.399

0.350

 0.030-4.124

rs12984929

MAF

0.341

0.400

Allele

0.537

0.778

 0.350-1.729

G > T

G/G

38 (46.3)

6 (40.0)

 

 

 

 

 

G/T

32 (39.0)

6 (40.0)

Dominant

0.650

0.772

 0.252-2.367

 

T/T

12 (14.6)

3 (20.0)

Recessive

0.697

0.686

 0.168-2.796

rs11672725

MAF

0.171

0.267

Allele

0.214

0.566

 0.229-1.401

C > T

C/C

55 (67.1)

8 (53.3)

 

 

 

 

 

C/T

26 (31.7)

6 (40.0)

Dominant

0.305

0.561

 0.184-1.709

 

T/T

1 (1.2)

 1 (6.7)

Recessive

0.287

0.173

 0.010-2.927

rs6509368

MAF

0.372

0.400

Allele

0.771

0.888

 0.401-1.969

G > A

G/G

35 (42.7)

6 (40.0)

 

 

 

 

 

G/A

33 (40.2)

6 (40.0)

Dominant

0.847

0.895

 0.292-2.749

A/A

14 (17.1)

3 (20.0)

Recessive

0.723

0.824

 0.205-3.306

PYCARD

rs8056505

MAF

0.177

0.100

Allele

0.424

1.933

 0.549-6.807

 

T > C

T/T

56 (68.3)

12 (80.0)

 

 

 

 

 

 

T/C

23 (28.0)

2 (20.0)

Dominant

0.542

1.857

 0.482-7.148

 

C/C

3 (3.7)

0 (0)

Recessive

1.000

1.365

 0.067-27.78

CASP1

rs2282659

MAF

0.317

0.267

Allele

0.583

1.277

 0.533-3.058

 

A > G

A/A

35 (42.7)

8 (53.3)

 

 

 

 

 

 

A/G

42 (51.2)

6 (40.0)

Dominant

0.445

1.535

 0.508-4.632

 

G/G

5 (6.1)

1 (6.7)

Recessive

1.000

0.909

 0.099-8.382

IL18

rs5744247

MAF

0.457

0.367

Allele

0.358

1.456

 0.652-3.251

 

C > G

C/C

24 (29.3)

5 (33.3)

 

 

 

 

 

 

C/G

41 (50.0)

9 (60.0)

Dominant

0.765

1.208

 0.373-3.909

 

G/G

17 (20.7)

1 (6.7)

Recessive

0.290

3.662

 0.449-29.85

 

rs2043055

MAF

0.409

0.400

Allele

0.930

1.036

 0.468-2.292

 

A > G

A/A

30 (36.6)

5 (33.3)

 

 

 

 

 

 

A/G

37 (45.1)

8 (53.3)

Dominant

1.000

0.867

 0.271-2.775

 

G/G

15 (18.3)

2 (13.3)

Recessive

1.000

1.455

 0.297-7.138

 

rs7106524

MAF

0.396

0.433

Allele

0.704

0.859

 0.391-1.886

 

G > A

G/G

29 (35.4)

5 (33.3)

 

 

 

 

 

 

G/A

41 (50.0)

7 (46.7)

Dominant

1.000

0.914

 0.285-2.930

 

A/A

12 (14.6)

3 (20.0)

Recessive

0.697

0.686

 0.168-2.796

 

rs360717

MAF

0.104

0.200

Allele

0.133

0.463

 0.166-1.290

 

C > G

C/C

66 (80.5)

9 (60.0)

 

 

 

 

 

 

C/G

15 (18.3)

6 (40.0)

Dominant

0.082

0.364

 0.113-1.170

 

G/G

1 (1.2)

0 (0)

Recessive

1.000

0.571

 0.022-14.67

IL1B

rs1143643

MAF

0.415

0.500

Allele

0.385

0.708

0.325-1.546

 

G > A

G/G

27 (32.9)

4 (26.7)

 

 

 

 

 

 

G/A

42 (51.2)

7 (46.7)

Dominant

0.768

0.741

 0.216-2.543

 

A/A

13 (15.9)

4 (26.7)

Recessive

0.293

0.518

 0.143-1.880

 

rs1143633

MAF

0.396

0.500

Allele

0.289

0.657

 0.301-1.434

 

A > G

A/A

27 (32.9)

4 (26.7)

 

 

 

 

 

 

A/G

45 (54.9)

7 (46.7)

Dominant

0.768

0.741

 0.216-2.543

 

G/G

10 (12.2)

4 (26.7)

Recessive

0.222

0.382

 0.102-1.432

 

rs3136558

MAF

0.470

0.467

Allele

0.977

1.012

 0.464-2.207

 

T > C

T/T

21 (25.6)

4 (26.7)

 

 

 

 

 

 

T/C

45 (54.9)

8 (53.3)

Dominant

1.000

1.056

 0.303-3.676

 

C/C

16 (19.5)

3 (20.0)

Recessive

1.000

0.970

 0.244-3.846

 

rs1143630

MAF

0.152

0.100

Allele

0.580

1.619

 0.456-5.744

 

C > A

C/C

60 (73.2)

12 (80.0)

 

 

 

 

 

 

C/A

19 (23.2)

3 (20.0)

Dominant

0.753

1.467

 0.378-5.692

 

 

A/A

3 (3.7)

0 (0)

Recessive

1.000

1.365

 0.067-27.780

 

rs16944

MAF

0.445

0.467

Allele

0.827

0.917

 0.420-2.001

 

G > A

G/G

26 (31.7)

4 (26.7)

 

 

 

 

 

 

G/A

29 (47.6)

8 (53.3)

Dominant

0.772

0.783

 0.228-2.694

 

A/A

17 (20.7)

3 (20.0)

Recessive

1.000

1.046

 0.265-4.131

rs1143623

MAF

0.354

0.333

Allele

0.830

1.094

 0.480-2.494

G > C

G/G

35 (42.7)

7 (46.7)

 

 

 

 

 

G/C

36 (43.9)

6 (40.0)

Dominant

0.775

1.175

 0.389-3.547

C/C

11 (13.4)

2 (13.3)

Recessive

1.000

1.007

 0.200-5.081

Table 5. Allele and genotype comparisons in three inheritance models between responders and non-responders to IFX after 2 years of treatment for CD patients.

* Allele: allele model; Dominant: the minor allele dominant model; Recessive: the minor allele recessive model. (IFX, infliximab; CD, Crohn's disease; SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval; MAF, minor allele frequency).

  No significant differences in the frequencies of alleles and genotypes at tag SNPs were observed between responders and non-responders after 2 years of treatment (Table 5).

The interaction of genetic and environmental factors in response to IFX after 10 weeks of treatment

Univariate analyses of the differences in the frequencies of the genotypes between responders and non-responders indicated that genetic factors, the C/C genotype of rs11670259 in CARD8 and the G/G genotype of rs1143623 in IL1B, as well as the environmental factor of female gender showed response to IFX after 10 weeks of treatment. Subsequently, multivariate logistic regression analysis revealed that only the C/C genotype of rs11670259 in CARD8 independently contributed to response to IFX (P = 0.017, OR = 5.391; Table 6). Conversely, the C/T or T/T genotype of rs11670259 in CARD8 contributed to primary non-response to IFX after 10 weeks of treatment.

Factor

OR (95% CI)

P value*

 
 

C/C genotype of rs11670259 in CARD8

5.391 (1.352 - 21.49)

0.017

 

G/G genotype of rs1143623 in IL1B

8.293 (0.966 - 71.21)

0.054

 

Female

7.364 (0.852 - 63.62)

0.070

 

Table 6. The interaction of genetic and environmental factors for response to IFX after 10 weeks of treatment for CD patients.

*Factors were statistically analyzed by multivariate logistic regression analysis.( IFX, infliximab; CD, Crohn's disease; OR, odds ratio; CI, confidence interval).

The gene-gene interaction in response to IFX after 1 year of treatment

Likewise, in order to investigate the influence of the interaction of associated genetic factors on response to IFX after 1 year of treatment, multivariate logistic regression analysis indicated that three genetic factors, the T/T or T/G genotype of rs3751143 in P2RX7, the C/C genotype of rs4389238 in CARD8, and the A/G or G/G genotype of rs2282659 in CASP1, independently contributed to response to IFX (P = 0.012, OR = 6.379, P = 0.013, OR = 5.114, P = 0.004, OR = 7.803, respectively; Table 7).

 

Factor

 

OR (95% CI)

 

P value*

 
 

T/T or T/G genotype of rs3751143 in P2RX7

6.379 (1.498 - 27.17)

0.012

 

C/C genotype of rs4389238 in CARD8

5.114 (1.416 - 18.48)

0.013

 

A/G or G/G genotype of rs2282659 in CASP1

7.803 (1.938 - 31.42)

0.004

 

Table 7. Gene-gene interaction among P2RX7, CARD8, and CASP1 genotypes for response to IFX after 1 year of treatment for CD patients.

*Factors were statistically analyzed by multivariate logistic regression analysis. (IFX, infliximab; CD, Crohn's disease; OR, odds ratio; CI, confidence interval).

  Conversely, the G/G genotype of rs3751143 in P2RX7, the C/T or T/T genotype of rs4389238 in CARD8, and the A/A genotype of rs2282659 in CASP1 independently contributed to loss of response to IFX after 1 year of treatment.

Verification of genetic test to predict response to IFX after 10 weeks of treatment

In order to predict response to IFX for CD patients after 10 weeks of treatment, genetic test was carried out using an independent genetic factor, the C/C genotype of rs11670259 in CARD8, as a biomarker (Table 8). This test indicated that the sensitivity, specificity, positive predictive value, and negative predictive value were estimated to be at 68.1%, 63.6%, 95.2%, and 15.9%, respectively (Table 8).

Biomarker

Statistical results

Genetic diagnosis

OR (95% CI)

P value*

sensitivity

specificity

PPV

NPV

C/C genotype of rs11670259 in CARD8

3.736 (1.029 - 13.57)

0.047

68.1

63.6

95.2

15.9

Table 8. Genetic factor determined by genetic test for response to IFX after 10 weeks of treatment for CD patients.

*Factors were statistically analyzed by Fisher's exact test. (IFX, infliximab; CD, crohn's disease; OR, odds ratio; CI, confidence interval; PPV, positive predictive value; NPV, negative predictive value).

Verification of genetic test to predict response to IFX after 1 year of treatment

Likewise, we performed genetic test with a combination of the three independent genetic factors as biomarkers to better predict response to IFX for CD patients after 1 year of treatment, indicating that the best combination of marker 6 (T/T or T/G genotype of rs3751143 in P2RX7 and A/G or G/G genotype of rs2282659 in CASP1) was useful as a biomarker with the values of the highest scores of the P value, OR, sensitivity, specificity, and positive predictive value (Table 9).

Biomarker

P2RX7

CARD8

CASP1

Statistical results

Genetic diagnosis

rs3751143

rs4389238

rs2282659

OR (95% CI)

P value*

sensitivity

specificity

PPV

NPV

marker 1

T/T or T/G

-

-

7.000 (1.961 - 24.99)

0.004

93.8

31.6

87.5

50.0

marker 2

-

C/C

-

4.333 (1.341 - 14.01)

0.012

53.6

78.9

92.9

25.0

marker 3

-

-

A/G or G/G

6.698 (1.831 - 24.50)

0.002

55.7

84.2

94.7

27.1

marker 4

T/T or T/G

C/C

-

5.444 (1.490 - 19.90)

0.006

50.5

84.2

94.2

25.0

marker 5

-

C/C

A/G or G/G

6.592 (0.837 - 51.91)

0.071

26.8

94.7

96.3

20.2

marker 6

T/T or T/G

-

A/G or G/G

9.424 (2.064 - 43.04)

0.001

52.6

89.5

96.2

27.0

marker 7

T/T or T/G

C/C

A/G or G/G

6.250 (0.792 - 49.28)

0.069

25.8

94.7

96.2

20.0

Table 9. Combination of genetic factors determined by genetic test for response to IFX after 1 year of treatment for CD patients. *Factors were statistically analyzed by Fisher's exact test. (IFX, infliximab; CD, crohn's disease; OR, odds ratio; CI, confidence interval; PPV, positive predictive value; NPV, negative predictive value)

Discussion

  This study is the first demonstration to report that the polymorphisms of CARD8, P2RX7, and CASP1 independently contribute to the therapeutic effect of IFX for CD patients.

  From the pathophysiological perspective at 10 weeks after the start of IFX administration, the C/C genotype at rs11670259 in CARD8 may decrease the function of CARD8 in the genetic background, thereby leading to the diminution of the production of inflammatory cytokines as well as inflammatory mediators through the P2RX7 signaling pathway [14-19]. Therefore, not only the suppression of the TNFR signaling pathway due to IFX, but also the diminution of the P2RX7 signaling pathway due to this polymorphism may show good response to IFX after 10 weeks of treatment (Figure 2).

  In contrast, the C/T or T/T genotype of rs11670259 in CARD8 may increase the function of CARD8 in the genetic background, thereby leading to the acceleration of the production of inflammatory cytokines and mediators through the P2RX7 signaling pathway. The condition with the elevated production of inflammatory cytokines and mediators through the activation of the P2RX7 signaling pathway due to this polymorphism may predominate over that with the suppressed production of inflammatory cytokines and mediators through the TNFR signaling pathway due to IFX. Therefore, the CD patients under such conditions may eventually result in primary non-response after 10 weeks of treatment (Figure 3).

  At 1 year after the start of IFX administration, the T/T or T/G genotype of rs3751143 in P2RX7, the C/C genotype of rs4389238 in CARD8, or A/G or G/G genotype at rs2282659 in CASP1 may slightly reduce the function of P2RX7, CARD8, and CASP1 in the genetic background, thereby leading to a decrease in the production of inflammatory cytokines and mediators through the P2RX7 signaling pathway. As similar to the mechanism observed after 10 weeks of treatment, in these CD patients, both the diminution of the P2RX7 signaling pathway due to these polymorphisms and the suppression of the TNFR signaling pathway due to IFX may show good response to IFX after 1 year of treatment (Figure 2).

  Conversely, the G/G genotype of rs3751143 in P2RX7, the C/T or T/T genotype of rs4389238 in CARD8, and A/A genotype at rs2282659 in CASP1 may slightly accelerate the function of P2RX7, CARD8, and CASP1 in the genetic background, thereby leading to an increase in the production of inflammatory cytokines and mediators through the P2RX7 signaling pathway. Therefore, not only the elevated production of inflammatory cytokines and mediators through the accelerated P2RX7 signaling pathway due to these polymorphisms, but also a decrease in the suppressed production of inflammatory cytokines and mediators through the TNFR signaling pathway due to the reduction of the IFX actions, may exacerbate inflammation of the intestines in the patients and eventually lead to secondary loss of response to IFX after 1 year of treatment (Figure 3). Although the decisive factors have not yet been identified, the reduction of the IFX actions after 1 year of treatment may be caused by various clinical risk factors, including a shortened half-life of IFX due to the increased clearance of IFX, the dominant mechanism of inflammation, the production of antibodies to IFX (ATI), and the low serum concentrations of the IFX levels (up to 60%) [29,30]. Indeed, approximately 15-61% of CD patients developed ATI [31-33], although ATI was not examined in this study. Of course, since these CD patients, who showed secondary loss of response after 1 year of treatment, showed response to IFX at the 10-week treatment, at 10 weeks after the start of IFX administration, the condition with the suppressed production of inflammatory cytokines and mediators through the TNFR signaling pathway due to IFX may predominate over that with the slightly elevated production of inflammatory cytokines and mediators through the activation of the P2RX7 signaling pathway due to the polymorphisms in the genetic background.

  With regard to genetic test with the IFX-related polymorphisms, the C/C genotype at rs11670259 in CARD8 is useful as a biomarker to predict response to IFX for CD patients after 10 weeks of treatment with significant differences (Table 8). As this test showed the sensitivity of 68.1%, we hypothesize that the activation of the P2RX7 signaling pathway may contribute to inflammation of the intestines in about two-thirds of the CD patients who showed good response to IFX after 10 weeks of treatment. Moreover, the positive predictive value of this test was very higher at 95.2%, thereby indicating the very higher probability that almost all of the CD patients with the C/C genotype of rs11670259 in CARD8 could show good response to IFX after 10 weeks of treatment.

  On the other hand, after 1 year of treatment, genetic test showed the combination marker 6 (T/T or T/G genotype of rs3751143 in P2RX7 and A/G or G/G genotype of rs2282659 in CASP1) could be useful as a biomarker to predict response to IFX for CD patients with significant differences (Table 9). As similar to the mechanism observed after 10 weeks of treatment, the sensitivity of 52.6% was seen in the genetic test after 1 year of treatment, indicating that the activation of the P2RX7 signaling pathway may contribute to inflammation of the intestines in about half of all CD patients who showed good response to IFX after 1 year of treatment. Likewise, the positive predictive value of 96.2% shown in the test indicates the very higher probability that almost all of the CD patients with both the T/T or T/G genotype of rs3751143 in P2RX7 and A/G or G/G genotype of rs2282659 in CASP1 could show good response to IFX after 1 year of treatment.

  In the patients who show secondary loss of response to IFX, remission can be managed by shortening interval between dosing [34], dose intensification [35], and/or switching to other biological agents [36,37]. For example, adalimumab is a fully humanized monoclonal antibody approved for the treatment of CD patients who have failed to respond to conventional agents and anti-TNF-α therapies [30,36]. Certolizumab pegol is a pegylated humanized monoclonal Fab' fragment that binds to TNF-α [30,37,38]. Natalizumab is a humanized monoclonal antibody against α4 integrin [39,40]. When these agents are chosen for the treatment of CD, then useful biomarkers to predict response or loss of response to IFX would be required.

  Finally, not only the antagonists of P2RX7 [14,20], but also other molecules involved in the P2RX7 signaling pathway could be targets for newly developed therapeutic agents to combat primary non-response and secondary loss of response to IFX for CD patients.

Conclusion

This is the first report to show that CARD8 is related to response and primary non-response to IFX after 10 weeks of treatment, and P2RX7, CARD8, and CASP1 are related to response and secondary loss of response to IFX after 1 year of treatment for Japanese CD patients. The polymorphism, the C/C genotype at rs11670259 in CARD8, and the combination polymorphisms, T/T or T/G genotype of rs3751143 in P2RX7 and A/G or G/G genotype of rs2282659 in CASP1, were found to useful as biomarkers to predict response to IFX after 10 weeks and 1 year of treatment, respectively. These molecules including P2RX7, CARD8, and CASP1 in the P2RX7 signaling pathway could therefore become targets for new therapeutic drugs and thereby help patients to overcome primary non-response and secondary loss of response to IFX in CD patients.

Acknowledgement

We are grateful to the physicians and CD patients for participating in this study. This work was supported by a Grant-in-Aid for Scientific Research (C) (KAKENHI No. 16K08912) from the Ministry of Education, Culture, Sports, Science and Technology of Japan (K. Tsukamoto) and a research grant from the Non-Profit Organization Aimed to Support Community Medicine Research in Nagasaki, Japan (K. Tsukamoto).

Conflicts of interest

The authors declare that they have no competing interests in association with this study.

References

  1. Xavier RJ, Podolsky DK (2007) Unravelling the pathogenesis of inflammatory bowel disease. Nature 448: 427-434. [Crossref]
  2. Cho JH (2008) The genetics and immunopathogenesis of inflammatory bowel disease. Nat Rev Immunol 8: 458-466. [Crossref]
  3. Abraham C, Cho JH (2009) Inflammatory bowel disease. N Engl J Med 361: 2066-2078. [Crossref]
  4. Lichtenstein GR, Hanauer SB, Sandborn WJ; Practice Parameters Committee of American College of Gastroenterology (2009) Management of Crohn's disease in adults. Am J Gastroenterol 104: 465-483. [Crossref]
  5. Ueno F, Matsui T, Matsumoto T, Matsuoka K, Watanabe M, et al. (2013) Evidence-based clinical practice guidelines for Crohn's disease, integrated with formal consensus of experts in Japan. J Gastroenterol 48: 31-72. [Crossref]
  6. van Deventer SJ (1999) Review article: targeting TNF alpha as a key cytokine in the inflammatory processes of Crohn's disease--the mechanisms of action of infliximab. Aliment Pharmacol Ther 13 Suppl 4: 3-8. [Crossref]
  7. Hanauer SB, Feagan BG, Lichtenstein GR, Mayer LF, Schreiber S, et al. (2002) Maintenance infliximab for Crohn's disease: the ACCENT I randomised trial. Lancet 359: 1541-1549. [Crossref]
  8. Rooryck C, Barnetche T, Richez C, Laleye A, Arveiler B, et al. (2008) Influence of FCGR3A-V212F and TNFRSF1B-M196R genotypes in patients with rheumatoid arthritis treated with infliximab therapy. Clin Exp Rheumatol 26: 340-342. [Crossref]
  9. Cañete JD, Suárez B, Hernández MV, Sanmartí R, Rego I, et al. (2009) Influence of variants of Fc gamma receptors IIA and IIIA on the American College of Rheumatology and European League Against Rheumatism responses to anti-tumour necrosis factor alpha therapy in rheumatoid arthritis. Ann Rheum Dis 68: 1547-1552.
  10. Tan RJL, Gibbons LJ, Potter C, Hyrich KL, Morgan AW, et al. (2010) Investigation of rheumatoid arthritis susceptibility genes identifies association of AFF3 and CD226 variants with response to anti-tumour necrosis factor treatment. Ann Rheum Dis 69: 1029-1035.
  11. Cui J, Saevarsdottir S, Thomson B, Padyukov L, van der Helm-van Mil AHM, et al. (2010) Rheumatoid arthritis risk allele PTPRC is also associated with response to anti-tumor necrosis factor? therapy. Arthritis Rheum 62: 1849-1861.
  12. Coulthard LR, Taylor JC, Eyre S; Biologics in Rheumatoid Arthritis Genetics and Genomics, Robinson JI, Wilson AG, et al. (2011) Genetic variants within the MAP kinase signalling network and anti-TNF treatment response in rheumatoid arthritis patients. Ann Rheum Dis 70: 98-103. [Crossref]
  13. Urabe S, Isomoto H, Ishida T, Maeda K, Inamine T, et al. (2015) Genetic polymorphisms of IL-17F and TRAF3IP2 could be predictive factors of the long-term effect of Infliximab against Crohn's disease. Biomed Res Int 4: 1-12
  14. Mehta N, Kaur M, Singh M, Chand S, Vyas B, et al. (2014) Purinergic receptor P2Xa: a novel target for anti-inflammatory therapy. Bioorg Med Chem 22: 54-88. [Crossref]
  15. Sim JA, Young MT, Sung HY, North RA, Surprenant A (2004) Reanalysis of P2X7 receptor expression in rodent brain. J Neurosci 24: 6307-6314. [Crossref]
  16. Kahlenberg JM, Dubyak GR (2004) Mechanisms of caspase-1 activation by P2X7 receptor-mediated K+ release. Am J Physiol Cell Physiol 286: C1100-1108. [Crossref]
  17. Mehta VB, Hart J, Wewers MD (2001) ATP-stimulated release of interleukin (IL)-1beta and IL-18 requires priming by lipopolysaccharide and is independent of caspase-1 cleavage. J Biol Chem 276: 3820-3826. [Crossref]
  18. Bulanova E, Budagian V, Orinska Z, Hein M, Petersen F, et al. (2005) Extracellular ATP induces cytokine expression and apoptosis through P2X7 receptor in murine mast cells. J Immunol 174: 3880-3890. [Crossref]
  19. Ferrari D, Wesselborg S, Bauer MKA, Schulze-Osthoff K (1997) Extracellular ATP activates transcription factor NF-?B through the P2Z purinoreceptor by selectively targeting NF-?B p65 (RelA). J Cell Biol 139: 1635-1643.
  20. McCulloch CA, Downey GP, El-Gabalawy H (2006) Signalling platforms that modulate the inflammatory response: new targets for drug development. Nat Rev Drug Discov 5: 864-876. [Crossref]
  21. Fantuzzi G, Ku G, Harding MW, Livingston DJ, Sipe JD, et al. (1997) Response to local inflammation of IL-1 beta-converting enzyme- deficient mice. J Immunol 158: 1818-1824. [Crossref]
  22. Solle M, Labasi J, Perregaux DG, Stam E, Petrushova N, et al. (2001) Altered cytokine production in mice lacking P2X(7) receptors. J Biol Chem 276: 125-132. [Crossref]
  23. Labasi JM, Petrushova N, Donovan C, McCurdy S, Lira P, et al. (2002) Absence of the P2X7 receptor alters leukocyte function and attenuates an inflammatory response. J Immunol 168: 6436-6445.
  24. Schoultz I, Verma D, Halfvarsson J, Törkvist L, Fredrikson M, et al. (2009) Combined polymorphisms in genes encoding the inflammasome components NALP3 and CARD8 confer susceptibility to Crohn's disease in Swedish men. Am J Gastroenterol 104: 1180-1188. [Crossref]
  25. Kurashima Y, Amiya T, Nochi T, Fujisawa K, Haraguchi T, et al. (2012) Extracellular ATP mediates mast cell-dependent intestinal inflammation through P2X7 purinoceptors. Nat Commun 3: 1034. [Crossref]
  26. Best WR, Becket JM, Singleton JW, Kern F Jr (1976) Development of a Crohn's disease activity index: National Cooperative Crohn's Disease Study. Gastroenterology 70: 439-444.
  27. Nanashima K, Mawatari T, Tahara N, Higuchi N, Nakaura A, et al. (2012) Genetic variants in antioxidant pathway: risk factors for hepatotoxicity in tuberculosis patients. Tuberculosis (Edinb) 92: 253-259. [Crossref]
  28. Mawatari T, Yoshida E, Higuchi N, Sato K, Inamine T, et al. (2016) A combination polymorphism of the glutathione synthesis genes can be a predictive biomarker for anti-tuberculosis drug-induced hepatotoxicity in Japanese patients with pulmonary tuberculosis. J Lung Dis and Treat 2: 105.
  29. Maharshak N, Plevy SE (2011) A Crohn's disease patient who does not respond to infliximab: what is next? Clin Gastroenterol Hepatol 9: 1033-1038. [Crossref]
  30. Yanai H, Hanauer SB (2011) Assessing response and loss of response to biological therapies in IBD. Am J Gastroenterol 106: 685-698. [Crossref]
  31. Baert F, Noman M, Vermeire S, Van Assche G, D' Haens G, et al. (2003) Influence of immunogenicity on the long-term efficacy of infliximab in Crohn's disease. N Engl J Med 348: 601-608. [Crossref]
  32. Hanauer SB, Wagner CL, Bala M, Mayer L, Travers S, et al. (2004) Incidence and importance of antibody responses to infliximab after maintenance or episodic treatment in Crohn's disease. Clin Gastroenterol Hepatol 2: 542-553. [Crossref]
  33. Ungar B, Chowers Y, Yavzori M, Picard O, Fudim E, et al. (2014) The temporal evolution of antidrug antibodies in patients with inflammatory bowel disease treated with infliximab. Gut 63: 1258-1264. [Crossref]
  34. Kopylov U, Mantzaris GJ, Katsanos KH, Reenaers C, Ellul P, et al. (2011) The efficacy of shortening the dosing interval to once every six weeks in Crohn's patients losing response to maintenance dose of infliximab. Aliment Pharmacol Ther 33: 349-357.
  35. Gisbert JP, Panés J (2009) Loss of response and requirement of infliximab dose intensification in Crohn's disease: a review. Am J Gastroenterol 104: 760-767.
  36. Sandborn WJ, Rutgeerts P, Enns R, Hanauer SB, Colombel JF, et al. (2007) Adalimumab induction therapy for Crohn disease previously treated with infliximab: a randomized trial. Ann Intern Med 146: 829-838. [Crossref]
  37. Sandborn WJ, Abreu MT, D'Haens G, Colombel JF, Vermeire S, et al. (2010) Certolizumab pegol in patients with moderate to severe Crohn's disease and secondary failure to infliximab. Clin Gastroenterol Hepatol 8: 688-695. [Crossref]
  38. Sandborn WJ, Feagan BG, Stoinov S, Honiball PJ, Rutgeerts P, et al. (2007) Certolizumab pegol for the treatment of Crohn's disease. N Engl J Med 357: 228-238. [Crossref]
  39. Sandborn WJ, Colombel JF, Enns R, Feagan BG, Hanauer SB, et al. (2005) Natalizumab induction and maintenance therapy for Crohn's disease. N Engl J Med 353: 1912-1925. [Crossref]
  40. Targan SR, Feagan BG, Fedorak RN, Lashner BA, Panaccione R, et al. (2007) Natalizumab for the treatment of active Crohn's disease: results of the ENCORE Trial. Gastroenterology 132: 1672-1683. [Crossref].

Editorial Information

Editor-in-Chief

Ivan Gout
University College London

Article Type

Research Article

Publication history

Received date: December 04, 2016
Accepted date: December 26, 2016
Published date: December 29, 2016

Copyright

©2016 Tsukamoto K. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation

Tsukamoto K (2016) The evidence of genetic polymorphisms of genes involved in the P2RX7 signaling pathway as predictive biomarkers for response and loss of response to infliximab against Crohn's disease. Integr Mol Med 3: DOI: 10.15761/IMM.1000262.

Corresponding author

Kazuhiro Tsukamoto

Kazuhiro Tsukamoto, Department of Pharmacotherapeutics, Nagasaki University Graduate School of Biomedical Sciences, Sakamoto, Nagasaki, Japan

  

Characteristics

Number (%) of CD patients

Responders

Non-responders

10 weeks (n = 127)

   

Number (%)

116 (91.3)

11 (8.7)

Age, mean ± SD (years)

35.2 ± 11.8

35.3 ± 11.8

Male/female (%)

67/49 (57.8/42.2)

10/1 (90.9/9.1)

1 year (n = 116)

 

 

Number (%)

97 (83.6)

19 (16.4)

Age, mean ± SD (years)

35.2 ± 11.9

35.6 ± 11.7

Male/female (%)

56/41 (57.7/42.3)

11/8 (57.9/42.1)

2 years (n = 97)

 

 

Number (%)

82 (84.5)

15 (15.5)

Age, mean ± SD (years)

35.1 ± 11.9

35.3 ± 11.8

Male/female (%)

48/34 (58.5/41.5)

8/7 (53.3/46.7)

 

Table 1. Comparison of the characteristics between responders and non-responders to IFX in CD patients. (IFX, infliximab; CD, Crohn's disease; SD, standard deviation).

Gene

tag SNP

Major > Minor

Sequence of primer (5' to 3')

Annealing temperature (°C)

Cycle number

Analytic method (Restriction enzyme)

Forward

Reverse

P2RX7

rs684201

G > A

ATCTGATTTCCCCCACCAAC

GACTGGGAGCTTCCATTATGC

55

30

PCR-RFLP (BsrD I)

 

rs656612

A > C

GCAATTGCTGACCCCCTATT

CAACAGCTTGGTGGTCACAG

56

30

PCR-RFLP (Cac8 I)

 

rs11065450

C > A

GTGCCGGGTTCTGTTCTTAG

GCTTGGGTCTCCTGTTGTGT

57

50

PCR-HRM

 

rs1718125

G > A

GGCTGGTGCTCTTTGGTAGA

GGGTGAGATCCAGGAGATGA

57

30

PCR-RFLP (Bsh1236 I)

 

rs1186055

G > T

GAAGATCTGGGGGAAGGAAG

GCTTGGCACAAACTAGTATCTCTGG

56

50

PCR-HRM

 

rs208296

C > T

AGCCATTTTCCCAAGGACAC

GGGGGAAGGAAGTTTTCTCA

55

30

PCR-RFLP (Xsp I)

 

rs11065464

C > A

GGCAAGCAACTCCCTGAACT

GGCATTTACTGTGGCACCTC

58

30

PCR-RFLP (Mae III)

 

rs208307

G > C

TGGGACACTGTGGATTCTGA

AGGAGGCAGTGATCATTTGG

55

30

PCR-RFLP (HpyCH4 V)

 

rs7958311

G > A

AACGGTGATGTGTCCCAGAC

CCACTGGGTGAGTTTGACCT

57

30

PCR-RFLP (Fok I)

 

rs1653609

A > C

CACCCATAATTCCCCTACCC

AGAATTTTGAGTGGCTGTGG

54

30

PCR-RFLP (Mbo I)

 

rs3751143

T > G

TGTCTGGACAGGACCAGCTT

TTCCTGGACAACCAGAGGAG

59

30

PCR-RFLP (Hha I)

CARD8

rs1971783

T > C

CCAATAGCTTATATGCCCAGAAGG

CAGGTGAACACTCCAGCAAAT

55

30

PCR-RFLP (BsaA I)

 

rs4389238

C > T

AATAGGGTTCGCGCTCCTAC

TGCCCAGGAAGAAGGACATA

57

30

PCR-RFLP (Fau I)

 

rs4802448

G > A

ACAGGTGCTGTTGGGATACAG

TCCAGTCCTCAGCAAATGGT

57

50

PCR-HRM

 

rs4802449

G > A

ACTTGACCACACCTGGGAAG

GCTACCCGAATCCATAGCAA

57

30

PCR-RFLP (Dde I)

 

rs10418189

G > A

ACAGCGCATCCCAGATCAT

ACCTCAAGGGCATAGACTGCT

57

30

PCR-direct DNA sequencing

 

rs2043211

A > T

CCCCTGAGTTCGATGAAAAA

TAGGGGCCTGAGGAATGACT

53

30

PCR-RFLP (Mbo I)

 

rs16981845

T > C

CTCAGACTCCCATGACTCTTTCTT

TCACTAATGCCCTGCAATCC

55

30

PCR RFLP (Hsp92 II)

 

rs11670259

C > T

CCATGGGAGTTTTCCCTTCA

CCGAGACGGTGAGTGACTTT

56

50

PCR-HRM

rs12984929

G > T

CCAACCTGACAGAGGCAAAA

GAGGGTGGACACATACATTCG

56

30

PCR-RFLP (Hinc II)

rs11672725

C > T

CCCTGGCCCAGAGAAATAAT

CGCAGGCTGTGAGAAGCATA

56

50

PCR-HRM

rs6509368

G > A

TCAACCAGCTTATCTGAATGTTAGC

GTTGACCATGTTCCGCAAA

55

30

PCR-RFLP (Afa I)

rs1972619

G > A

TGGAAGCATTGTGTGTGTGTG

ACTGTGTTTGGGGAGCAGAC

56

30

PCR-RFLP (Hpy8 I)

PYCARD

rs8056505

T > C

AGGGGAGCCAGAATTTGATC

CCTCCACCACACACAGCTAT

56

30

PCR-RFLP (HpyCH4 IV)

CASP1

rs2282659

A > G

GGAGCGGGGTGAAACTAAAT

CCACAATGGGCTCTGTTTTT

54

30

PCR-RFLP (Ban II)

IL18

rs5744247

C > G

GAGAAAGAGGGCCACCAAAT

TGGCCTAGTACTGAACTGAATC

54

30

PCR-RFLP (Ple I)

 

rs2043055

A > G

CCTCCACCTGAAAGCCAAT

TCCTGGGAGGATCTTTCTGA

55

30

PCR-RFLP (Rsa I)

 

rs7106524

G > A

GTGGCTGAACTCACCACAGA

CTTTCAGGCCAGGTGCACTA

57

50

PCR-HRM

 

rs360717

C > G

CCATGGCTGACTTTCCAAAT

GCACAGAGCCCCAACTTTTA

54

30

PCR-RFLP (Aci I)

IL1B

rs1143643

G > A

AAAAGCCCCTGGAAACTAGG

CACATGATCAGGAGCCAGAC

54

50

PCR-HRM

rs1143633

A > G

TGTTCTTAGCCACCCCACTC

TCCATATCCTGTCCCTGGAG

56

30

PCR-RFLP (Fun4H I)

rs3136558

T > C

GGTGTCAGAAAGCCCACATT

GAGGAGGAAAGGGCTTGAAA

55

30

PCR-RFLP (Mbo I)

rs1143630

C > A

AGGTGGGGCATGTACAAAAA

AGATTATCCCTCTCTGAAGCTC

54

50

PCR-HRM

rs16944

G > A

GCCCTCCCTGTCTGTATTGA

AGGCACTTTGCTGGTGTCTC

56

30

PCR-RFLP (Ava I)

rs1143623

G > C

ATCAGAAGGCTGCTTGGAGA

AAACCTTGCTCCTCCTGGTT

56

30

PCR-RFLP (BseD I)

Table 2. Information on genotyping of tag SNPs in the candidate genes (SNP, single nucleotide polymorphism; 3'-UTR, 3'-untranslated region; PCR, polymerase chain reaction; RFLP, restriction fragment length polymorphism; HRM, high resolution melting).

Gene

Tag SNP
(Major > Minor)

Genotype

Number (%) of CD patients

Inheritance model*

P value

OR

95% CI

Responders
(n = 116)

Non-responders
(n = 11)

P2RX7

rs684201

MAF

0.211

0.182

Allele

1.000

1.205

0.390-3.724

 

G > A

G/G

72 (62.1)

7 (63.6)

 

 

 

 

 

G/A

39 (33.6)

4 (36.4)

Dominant

1.000

1.069

0.296-3.864

 

 

A/A

5 (4.3)

0 (0)

Recessive

1.000

1.135

0.059-21.87

 

rs656612

MAF

0.306

0.409

Allele

0.320

0.637

0.260-1.558

 

A > C

A/A

52 (48.8)

3 (27.3)

 

 

 

 

 

A/C

57 (49.1)

7 (63.6)

Dominant

0.347

0.462

0.117-1.828

 

 

C/C

7 (6.0)

1 (9.1)

Recessive

0.526

0.642

0.072-5.757

 

rs11065450

MAF

0.332

0.409

Allele

0.465

0.718

0.294-1.752

 

C > A

C/C

51 (44.0)

3 (27.3)

 

 

 

 

 

C/A

53 (45.7)

7 (63.6)

Dominant

0.352

0.478

0.121-1.894

 

 

A/A

12 (10.3)

1 (9.1)

Recessive

1.000

1.154

0.136-9.814

 

rs1718125

MAF

0.263

0.273

Allele

0.921

0.951

0.356-2.541

 

G > A

G/G

63 (54.3)

5 (45.5)

 

 

 

 

 

G/A

45 (38.8)

6 (54.5)

Dominant

0.754

0.701

0.203-2.427

 

 

A/A

8 (6.9)

0 (0)

Recessive

1.000

1.802

0.097-33.31

 

rs1186055

MAF

0.392

0.590

Allele

0.070

0.447

0.184-1.088

 

G > T

G/G

42 (36.2)

1 (9.1)

 

 

 

 

 

G/T

57 (49.1)

7 (63.6)

Dominant

0.097

0.176

0.022-1.425

 

 

T/T

17 (14.7)

3 (27.3)

Recessive

0.378

0.458

0.110-1.900

 

rs208296

MAF

0.319

0.318

Allele

0.994

1.004

0.393-2.566

 

C > T

C/C

51 (44.0)

4 (36.4)

 

 

 

 

 

C/T

56 (48.3)

7 (63.6)

Dominant

0.756

0.728

0.202-2.625

 

 

T/T

9 (7.8)

0 (0.0)

Recessive

1.000

2.033

0.111-37.27

 

rs11065464

MAF

0.237

0.045

Allele

0.055

6.527

0.858-49.51

 

C > A

C/C

67 (57.8)

10 (90.9)

 

 

 

 

 

C/A

43 (37.1)

1 (9.1)

Dominant

0.049

7.315

0.906-59.17

 

 

A/A

6 (5.2)

0 (0.0)

Recessive

1.000

1.353

0.071-25.61

 

rs208307

MAF

0.147

0.318

Allele

0.205

0.536

0.201-1.425

 

G > C

G/G

86 (74.1)

6 (54.5)

 

 

 

 

 

G/C

26 (22.4)

3 (27.3)

Dominant

0.174

0.419

0.119-1.472

 

 

C/C

4 (3.4)

2 (18.2)

Recessive

0.085

0.161

0.026-1.000

 

rs7958311

MAF

0.349

0.182

Allele

0.156

2.414

0.790-7.375

 

G > A

G/G

53 (45.7)

8 (72.7)

 

 

 

 

 

G/A

45 (38.8)

2 (18.2)

Dominant

0.117

3.170

0.800-12.55

 

 

A/A

18 (15.5)

1 (9.1)

Recessive

1.000

1.837

0.221-15.24

 

rs1653609

MAF

0.280

0.364

Allele

0.408

0.681

0.273-1.700

 

A > C

A/A

59 (50.9)

4 (36.4)

 

 

 

 

 

A/C

49 (42.2)

6 (54.5)

Dominant

0.530

0.552

0.153-1.988

 

 

C/C

8 (6.9)

1 (9.1)

Recessive

0.570

0.741

0.084-6.536

 

rs3751143

MAF

0.319

0.455

Allele

0.196

0.562

0.232-1.361

 

T > G

T/T

54 (46.6)

2 (27.3)

 

 

 

 

 

T/G

50 (43.1)

6 (54.5)

Dominant

0.343

0.431

0.109-1.705

 

G/G

12 (10.3)

2 (18.2)

Recessive

0.348

0.519

0.100-2.689

CARD8

rs1971783

MAF

0.478

0.455

Allele

0.830

1.101

0.458-2.648

 

T > C

T/T

28 (24.1)

3 (27.3)

 

 

 

 

 

T/C

65 (56.0)

6 (54.5)

Dominant

0.729

1.179

0.293-4.748

 

 

C/C

23 (19.8)

2 (18.2)

Recessive

1.000

1.113

0.225-5.507

 

rs4389238

MAF

0.297

0.182

Allele

0.328

1.905

0.622-5.834

 

C > T

C/C

56 (48.3)

7 (63.6)

 

 

 

 

 

C/T

51 (44.0)

4 (36.4)

Dominant

0.364

1.875

0.521-6.752

 

 

T/T

9 (7.8)

0 (0)

Recessive

1.000

2.033

0.111-37.03

 

rs4802448

MAF

0.310

0.227

Allele

0.478

1.530

0.543-4.308

 

G > A

G/G

58 (50.0)

7 (63.6)

 

 

 

 

 

G/A

44 (37.9)

3 (27.3)

Dominant

0.531

1.750

0.486-6.301

 

 

A/A

14 (12.1)

1 (9.1)

Recessive

1.000

1.372

0.163-11.55

 

rs4802449

MAF

0.220

0.455

Allele

0.014

0.338

0.138-0.827

 

G > A

G/G

70 (60.3)

3 (27.3)

 

 

 

 

 

G/A

41 (35.3)

6 (54.5)

Dominant

0.053

0.246

0.062-0.978

 

 

A/A

5 (4.3)

2 (18.2)

Recessive

0.113

0.203

0.034-1.196

 

rs10418189

MAF

0.474

0.318

Allele

0.161

1.932

0.760-4.914

 

G > A

G/G

31 (26.7)

5 (45.5)

 

 

 

 

 

G/A

60 (51.7)

5 (45.5)

Dominant

0.291

2.285

0.651-8.026

 

 

A/A

25 (21.6)

1 (9.1)

Recessive

0.459

2.747

0.335-22.47

rs16981845

MAF

0.034

0.136

Allele

0.001

0.032

0.007-0.130

T > C

T/T

108 (93.1)

8 (72.7)

 

 

 

 

T/C

8 (6.9)

3 (27.3)

Dominant

0.055

0.198

0.044-0.894

 

C/C

0 (0)

0 (0)

Recessive

-

-

-

rs11670259

MAF

0.172

0.364

Allele

0.029

0.365

0.143-0.927

C > T

C/C

79 (68.1)

4 (36.4)

 

 

 

 

C/T

34 (29.3)

6 (54.5)

Dominant

0.047

0.268

0.074-0.971

 

T/T

3 (2.6)

1 (9.1)

Recessive

0.307

0.265

0.025-2.794

rs12984929

MAF

0.349

0.500

Allele

0.159

0.536

0.223-1.291

G > T

G/G

52 (44.8)

2 (18.2)

 

 

 

 

G/T

47 (40.5)

7 (63.6)

Dominant

0.115

0.274

0.057-1.322

 

T/T

17 (14.7)

2 (18.2)

Recessive

0.669

0.773

0.153-3.890

rs11672725

MAF

0.190

0.318

Allele

0.150

0.502

0.193-1.304

C > T

C/C

74 (63.8)

5 (45.5)

 

 

 

 

C/T

40 (34.5)

5 (45.5)

Dominant

0.330

0.473

0.136-1.644

 

T/T

2 (1.7)

1 (9.1)

Recessive

0.240

0.175

0.015-2.107

rs6509368

MAF

0.388

0.273

Allele

0.287

1.690

0.638-4.480

G > A

G/G

47 (40.5)

5 (45.5)

 

 

 

 

G/A

48 (41.4)

6 (54.5)

Dominant

0.758

1.223

0.353-4.243

A/A

21 (18.1)

0 (0)

Recessive

0.209

5.178

0.293-91.37

PYCARD

rs8056505

MAF

0.159

0.136

Allele

1.000

1.202

0.338-4.268

 

T > C

T/T

82 (70.2)

8 (72.7)

 

 

 

 

 

T/C

31 (26.7)

3 (27.3)

Dominant

1.000

1.106

0.277-4.421

 

C/C

3 (2.6)

0 (0)

Recessive

1.000

0.709

0.034-14.61

CASP1

rs2282659

MAF

0.273

0.364

Allele

0.358

0.652

0.261-1.630

 

A > G

A/A

59 (50.9)

3 (27.3)

 

 

 

 

 

A/G

51 (44.0)

8 (72.7)

Dominant

0.207

0.362

0.092-1.434

 

G/G

6 (5.2)

0 (0)

Recessive

1.000

1.353

0.070-25.61

IL18

rs5744247

MAF

0.440

0.364

Allele

0.492

1.373

0.555-3.399

 

C > G

C/C

34 (29.3)

6 (54.5)

 

 

 

 

 

C/G

62 (53.4)

2 (18.2)

Dominant

0.099

2.894

0.827-10.12

 

G/G

20 (17.2)

3 (27.3)

Recessive

0.418

0.556

0.135-2.279

 

rs2043055

MAF

0.414

0.364

Allele

0.648

1.235

0.499-3.060

 

A > G

A/A

39 (33.6)

5 (45.5)

 

 

 

 

 

A/G

58 (50.0)

4 (36.4)

Dominant

0.512

1.645

0.472-5.731

 

G/G

19 (16.4)

2 (18.2)

Recessive

1.000

0.881

0.176-4.405

 

rs7106524

MAF

0.414

0.364

Allele

0.648

1.235

0.499-3.060

 

G > A

G/G

38 (32.8)

4 (36.4)

 

 

 

 

 

G/A

60 (51.7)

6 (54.5)

Dominant

0.752

1.173

0.323-4.254

 

A/A

18 (15.5)

1 (9.1)

Recessive

1.000

1.837

0.221-15.24

 

rs360717

MAF

0.121

0.227

Allele

0.179

0.467

0.160-1.364

 

C > G

C/C

89 (76.7)

6 (54.5)

 

 

 

 

 

C/G

26 (22.4)

5 (45.5)

Dominant

0.143

0.364

0.103-1.287

 

G/G

1 (0.9)

0 (0)

Recessive

1.000

0.299

0.011-7.768

IL1B

rs1143643

MAF

0.422

0.545

Allele

0.266

0.609

0.253-1.468

 

G > A

G/G

38 (32.8)

1 (9.1)

 

 

 

 

 

G/A

58 (50.0)

8 (72.7)

Dominant

0.171

0.205

0.025-1.663

 

A/A

20 (17.2)

2 (18.2)

Recessive

1.000

0.937

0.188-4.673

 

rs1143633

MAF

0.405

0.545

Allele

0.202

0.568

0.236-1.367

 

A > G

A/A

38 (32.8)

2 (18.2)

 

 

 

 

 

A/G

62 (53.4)

6 (54.5)

Dominant

0.500

0.456

0.094-2.216

 

G/G

16 (13.8)

3 (27.3)

Recessive

0.213

0.427

0.102-1.779

 

rs3136558

MAF

0.491

0.364

Allele

0.252

1.691

0.683-4.184

 

T > C

T/T

27 (23.3)

4 (36.4)

 

 

 

 

 

T/C

64 (55.2)

6 (54.5)

Dominant

0.461

1.884

0.512-6.925

 

C/C

25 (21.6)

1 (9.1)

Recessive

0.459

2.747

0.335-22.47

 

rs1143630

MAF

0.151

0.273

Allele

0.138

0.474

0.173-1.294

 

C > A

C/C

84 (72.4)

7 (63.6)

 

 

 

 

 

C/A

29 (25.0)

2 (18.2)

Dominant

0.505

0.667

0.183-2.432

 

 

A/A

3 (2.6)

2 (18.2)

Recessive

0.059

0.119

0.018-0.810

rs16944

MAF

0.427

0.682

Allele

0.022

0.347

0.136-0.884

G > A

G/G

38 (32.8)

0 (0)

 

 

 

 

G/A

57 (49.1)

7 (63.6)

Dominant

0.033

0.089

0.005-1.545

A/A

21 (18.1)

4 (36.4)

Recessive

0.225

0.387

0.104-1.443

 

rs1143623

MAF

0.336

0.636

Allele

0.005

0.289

0.116-0.719

G > C

G/G

52 (44.8)

1 (9.1)

 

 

 

 

G/C

50 (43.1)

6 (54.5)

Dominant

0.025

0.123

0.015-0.993

C/C

14 (12.1)

4 (36.4)

Recessive

0.050

0.240

0.062-0.926

Table 3. Allele and genotype comparisons in three inheritance models between responders and non-responders to IFX after 10 weeks of treatment for CD patients.

*Allele: allele model; Dominant: the minor allele dominant model; Recessive: the minor allele recessive model.( IFX, infliximab; CD, Crohn's disease; SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval; MAF, minor allele frequency).

Gene

Tag SNP
(Major > Minor)

Genotype

Number (%) of CD patients

Inheritance model*

P value

OR

95% CI

Responders
(n = 97)

Non-responders
(n = 19)

P2RX7

rs684201

MAF

0.222

0.158

Allele

0.379

1.519

0.596-3.870

 

G > A

G/G

59 (60.8)

13 (68.4)

 

 

 

 

 

 

G/A

33 (34.0)

6 (31.6)

Dominant

0.533

1.395

0.488-3.987

 

 

A/A

5 (5.2)

0 (0)

Recessive

0.590

2.319

0.123-43.72

 

rs656612

MAF

0.320

0.237

Allele

0.312

1.514

0.676-3.390

 

A > C

A/A

41 (42.3)

11 (57.9)

 

 

 

 

 

 

A/C

50 (51.5)

7 (36.8)

Dominant

0.210

1.878

0.694-5.084

 

 

C/C

6 (6.2)

1 (5.3)

Recessive

1.000

1.187

0.135-10.46

 

rs11065450

MAF

0.361

0.184

Allele

0.035

2.500

1.046-5.974

 

C > A

C/C

39 (40.2)

12 (63.2)

 

 

 

 

 

 

C/A

46 (47.4)

7 (36.8)

Dominant

0.065

2.550

0.922-7.047

 

 

A/A

12 (12.4)

0 (0)

Recessive

0.211

5.702

0.323-100.6

 

rs1718125

MAF

0.273

0.211

Allele

0.422

1.410

0.608-3.270

 

G > A

G/G

51 (52.6)

12 (63.2)

 

 

 

 

 

 

G/A

39 (40.2)

6 (31.6)

Dominant

0.397

1.546

0.561-4.261

 

 

A/A

7 (7.2)

1 (5.3)

Recessive

1.000

1.400

0.162-12.09

 

rs1186055

MAF

0.392

0.395

Allele

0.973

0.988

0.485-2.012

 

G > T

G/G

36 (37.1)

6 (31.6)

 

 

 

 

 

 

G/T

46 (47.4)

11 (57.9)

Dominant

0.646

0.782

0.273-2.238

 

 

T/T

15 (15.5)

2 (10.5)

Recessive

0.735

1.555

0.325-7.435

 

rs208296

MAF

0.340

0.211

Allele

0.117

1.933

0.839-4.454

 

C > T

C/C

40 (41.2)

11 (57.9)

 

 

 

 

 

 

C/T

48 (49.5)

8 (42.1)

Dominant

0.181

1.959

 0.723-5.308

 

 

T/T

9 (9.3)

0 (0)

Recessive

0.352

4.186

 0.234-75.06

 

rs11065464

MAF

0.247

0.184

Allele

0.402

1.456

 0.602-3.520

 

C > A

C/C

54 (55.7)

13 (68.4)

 

 

 

 

 

 

C/A

38 (39.2)

5 (26.3)

Dominant

0.304

1.725

 0.606-4.916

 

 

A/A

5 (5.2)

1 (5.3)

Recessive

1.000

0.978

 0.108-8.881

 

rs208307

MAF

0.155

0.105

Allele

0.616

1.555

 0.514-4.704

 

G > C

G/G

70 (72.2)

16 (84.2)

 

 

 

 

 

 

G/C

24 (24.7)

2 (10.5)

Dominant

0.393

2.057

 0.555-7.628

 

 

C/C

3 (3.1)

1 (5.3)

Recessive

0.516

0.574

 0.057-5.838

 

rs7958311

MAF

0.361

0.289

Allele

0.399

1.386

 0.648-2.962

 

G > A

G/G

41 (42.3)

12 (63.2)

 

 

 

 

 

 

G/A

42 (43.3)

3 (15.8)

Dominant

0.095

2.341

 0.848-6.464

 

 

A/A

14 (14.4)

4 (21.1)

Recessive

0.492

0.633

 0.183-2.185

 

rs1653609

MAF

0.294

0.211

Allele

0.296

1.560

 0.674-3.610

 

A > C

A/A

46 (47.4)

13 (68.4)

 

 

 

 

 

 

A/C

45 (46.4)

4 (21.1)

Dominant

0.094

2.402

 0.844-6.840

 

 

C/C

6 (6.2)

2 (10.5)

Recessive

0.616

0.560

 0.104-3.013

 

rs3751143

MAF

0.289

0.474

Allele

0.025

0.451

0.222-0.916

 

T > G

T/T

47 (48.5)

7 (36.8)

 

 

 

 

 

 

T/G

44 (45.5)

6 (31.6)

Dominant

0.354

0.621

 0.225-1.710

 

G/G

6 (6.2)

6 (31.6)

Recessive

0.001

0.143

 0.040-0.510

CARD8

rs1971783

MAF

0.490

0.421

Allele

0.439

1.319

 0.653-2.665

 

T > C

T/T

21 (21.6)

7 (36.8)

 

 

 

 

 

 

T/C

57 (58.8)

8 (42.1)

Dominant

0.157

2.111

 0.739-6.031

 

 

C/C

19 (19.6)

4 (21.1)

Recessive

1.000

0.913

 0.272-3.068

 

rs4389238

MAF

0.268

0.447

Allele

0.027

0.452

 0.222-0.924

 

C > T

C/C

52 (53.6)

4 (21.1)

 

 

 

 

 

 

C/T

38 (39.2)

13 (68.4)

Dominant

0.012

0.231

 0.071-0.746

 

 

T/T

7 (7.2)

2 (10.5)

Recessive

0.640

0.661

 0.126-3.459

 

rs4802448

MAF

0.309

0.316

Allele

0.937

0.970

 0.459-2.051

 

G > A

G/G

48 (49.5)

10 (52.6)

 

 

 

 

 

 

G/A

38 (39.2)

6 (31.6)

Dominant

0.802

1.134

 0.424-3.036

 

 

A/A

11 (11.3)

3 (15.8)

Recessive

0.699

0.682

 0.171-2.722

 

rs4802449

MAF

0.216

0.237

Allele

0.782

0.890

 0.391-2.026

 

G > A

G/G

60 (61.9)

10 (52.6)

 

 

 

 

 

 

G/A

32 (33.0)

9 (47.4)

Dominant

0.452

0.685

 0.255-1.843

 

 

A/A

5 (5.2)

0 (0)

Recessive

0.590

2.319

 0.123-43.72

 

rs10418189

MAF

0.479

0.447

Allele

0.718

1.137

 0.566-2.288

 

G > A

G/G

25 (25.8)

6 (31.6)

 

 

 

 

 

 

G/A

51 (52.6)

9 (47.4)

Dominant

0.601

1.329

 0.456-3.871

 

 

A/A

21 (21.6)

4 (21.1)

Recessive

1.000

1.036

 0.311-3.454

 

rs16981845

MAF

0.036

0.026

Allele

1.000

1.385

0.165-11.49

 

T > C

T/T

90 (92.8)

18 (94.7)

 

 

 

 

 

 

T/C

7 (7.2)

1 (5.3)

Dominant

1.000

0.714

 0.083-6.169

 

 

C/C

0 (0)

0 (0)

Recessive

-

-

-

 

rs11670259

MAF

0.170

0.184

Allele

0.833

0.908

 0.368-2.236

 

C > T

C/C

67 (69.1)

12 (63.2)

 

 

 

 

 

 

C/T

27 (27.8)

7 (36.8)

Dominant

0.613

0.768

 0.275-2.143

 

 

T/T

3 (3.1)

0 (0)

Recessive

1.000

1.444

 0.071-29.41

 

rs12984929

MAF

0.351

0.342

Allele

0.921

1.038

 0.499-2.158

 

G > T

G/G

44 (45.4)

8 (42.1)

 

 

 

 

 

 

G/T

38 (39.2)

9 (47.4)

Dominant

0.794

0.876

 0.324-2.369

 

 

T/T

15 (15.5)

2 (10.5)

Recessive

0.735

1.555

 0.325-7.435

 

rs11672725

MAF

0.186

0.211

Allele

0.720

0.854

 0.362-2.019

 

C > T

C/C

63 (64.9)

11 (57.9)

 

 

 

 

 

 

C/T

32 (33.0)

8 (42.1)

Dominant

0.559

0.742

 0.273-2.021

 

 

T/T

2 (2.1)

0 (0)

Recessive

1.000

1.021

 0.047-22.22

 

rs6509368

MAF

0.376

0.447

Allele

0.411

0.745

 0.369-1.504

 

G > A

G/G

41 (42.3)

6 (31.6)

 

 

 

 

 

 

G/A

49 (40.2)

9 (47.4)

Dominant

0.386

0.630

 0.221-1.798

 

A/A

17 (17.5)

4 (21.1)

Recessive

0.747

0.797

 0.235-2.701

PYCARD

rs8056505

MAF

0.165

0.132

Allele

0.809

1.304

 0.473-3.595

 

T > C

T/T

68 (70.1)

14 (73.7)

 

 

 

 

 

 

T/C

26 (26.8)

5 (26.3)

Dominant

1.000

1.194

 0.394-3.623

 

C/C

3 (3.1)

0 (0)

Recessive

1.000

1.444

 0.072-29.12

CASP1

rs2282659

MAF

0.309

0.079

Allele

0.003

5.225

 1.546-17.67

 

A > G

A/A

43 (44.3)

16 (84.2)

 

 

 

 

 

 

A/G

48 (49.5)

3 (15.8)

Dominant

0.002

6.698

 1.832-24.51

 

G/G

6 (6.2)

0 (0)

Recessive

0.587

2.770

 0.150-51.29

IL18

rs5744247

MAF

0.443

0.421

Allele

0.801

1.095

 0.542-2.213

 

C > G

C/C

29 (29.9)

5 (26.3)

 

 

 

 

 

 

C/G

50 (51.5)

12 (63.2)

Dominant

1.000

0.837

 0.276-2.541

 

G/G

18 (18.6)

2 (10.5)

Recessive

0.521

1.937

 0.410-9.141

 

rs2043055

MAF

0.407

0.447

Allele

0.646

0.849

 0.421-1.710

 

A > G

A/A

35 (36.1)

4 (21.1)

 

 

 

 

 

 

A/G

45 (46.4)

13 (68.4)

Dominant

0.290

0.472

 0.145-1.535

 

G/G

17 (17.5)

2 (10.5)

Recessive

0.735

1.806

 0.381-8.562

 

rs7106524

MAF

0.402

0.474

Allele

0.412

0.747

 0.372-1.502

 

G > A

G/G

34 (35.1)

4 (21.1)

 

 

 

 

 

 

G/A

48 (49.1)

12 (63.2)

Dominant

0.293

0.494

 0.152-1.607

 

A/A

15 (15.5)

3 (15.8)

Recessive

1.000

0.976

 0.253-3.765

 

rs360717

MAF

0.119

0.132

Allele

0.788

0.888

 0.315-2.503

 

C > G

C/C

75 (77.3)

14 (73.7)

 

 

 

 

 

 

C/G

21 (21.6)

5 (26.3)

Dominant

0.769

0.821

 0.266-2.533

 

G/G

1 (1.0)

0 (0)

Recessive

1.000

0.606

 0.024-15.45

IL1B

rs1143643

MAF

0.428

0.395

Allele

0.706

1.147

0.564-2.331

 

G > A

G/G

31 (32.0)

7 (36.8)

 

 

 

 

 

 

G/A

49 (50.5)

9 (47.4)

Dominant

0.678

1.242

 0.446-3.463

 

A/A

17 (17.5)

3 (15.8)

Recessive

1.000

1.133

 0.297-4.327

 

rs1143633

MAF

0.421

0.368

Allele

0.614

1.203

 0.586-2.468

 

A > G

A/A

31 (32.0)

7 (36.8)

 

 

 

 

 

 

A/G

52 (53.6)

10 (52.6)

Dominant

0.678

1.242

 0.446-3.463

 

G/G

14 (14.4)

2 (10.5)

Recessive

1.000

1.434

 0.298-6.897

 

rs3136558

MAF

0.469

0.605

Allele

0.125

0.576

 0.284-1.171

 

T > C

T/T

25 (25.8)

2 (10.5)

 

 

 

 

 

 

T/C

53 (54.6)

11 (57.9)

Dominant

0.235

0.339

 0.073-1.571

 

C/C

19 (19.6)

6 (31.6)

Recessive

0.245

0.528

 0.178-1.569

 

rs1143630

MAF

0.144

0.184

Allele

0.530

0.747

 0.300-1.861

 

C > A

C/C

72 (74.2)

12 (63.2)

 

 

 

 

 

 

C/A

22 (22.7)

7 (36.8)

Dominant

0.324

0.595

 0.211-1.680

 

 

A/A

3 (3.1)

0 (0)

Recessive

1.000

1.444

 0.072-29.12

 

rs16944

MAF

0.448

0.316

Allele

0.131

1.762

 0.840-3.693

 

G > A

G/G

30 (30.9)

8 (42.1)

 

 

 

 

 

 

G/A

47 (48.5)

10 (52.6)

Dominant

0.343

1.624

 0.593-4.448

 

A/A

20 (20.6)

1 (5.3)

Recessive

0.190

4.675

 0.588-37.18

rs1143623

MAF

0.351

0.263

Allele

0.297

1.511

 0.693-3.296

G > C

G/G

42 (43.3)

10 (52.6)

 

 

 

 

 

G/C

42 (43.3)

8 (42.1)

Dominant

0.455

1.455

 0.543-3.900

C/C

13 (13.4)

1 (5.3)

Recessive

0.461

2.786

 0.342-22.68

Table 4. Allele and genotype comparisons in three inheritance models between responders and non-responders to IFX after 1 year of treatment for CD patients.

* Allele: allele model; Dominant: the minor allele dominant model; Recessive: the minor allele recessive model. (IFX, infliximab; CD, Crohn's disease; SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval; MAF, minor allele frequency).

Gene

Tag SNP
(Major > Minor)

Genotype

Number (%) of CD patients

Inheritance model*

P value

OR

95% CI

Responders
(n = 82)

Non-responders
(n = 15)

P2RX7

rs684201

MAF

0.244

0.100

Allele

0.096

2.904

 0.836-10.08

 

G > A

G/G

47 (57.3)

12 (80.0)

 

 

 

 

 

 

G/A

30 (36.6)

3 (20.0)

Dominant

0.150

2.979

 0.781-11.36

 

 

A/A

5 (6.1)

0 (0)

Recessive

1.000

2.200

 0.116-41.89

 

rs656612

MAF

0.317

0.333

Allele

0.861

0.929

 0.406-2.124

 

A > C

A/A

36 (43.9)

5 (33.3)

 

 

 

 

 

 

A/C

40 (48.8)

10 (66.7)

Dominant

0.574

0.639

 0.201-2.035

 

 

C/C

6 (7.3)

0 (0)

Recessive

0.586

2.634

 0.141-49.26

 

rs11065450

MAF

0.372

0.300

Allele

0.451

1.382

 0.595-3.209

 

C > A

C/C

33 (40.2)

6 (40.0)

 

 

 

 

 

 

C/A

37 (45.1)

9 (60.0)

Dominant

0.986

0.990

 0.322-3.044

 

 

A/A

12 (14.6)

0 (0)

Recessive

0.203

5.496

 0.308-97.95

 

rs1718125

MAF

0.299

0.133

Allele

0.075

2.769

 0.918-8.361

 

G > A

G/G

40 (48.8)

11 (73.3)

 

 

 

 

 

 

G/A

35 (42.7)

4 (26.7)

Dominant

0.097

2.888

 0.849-9.814

 

 

A/A

7 (8.5)

0 (0)

Recessive

0.591

3.079

 0.167-56.82

 

rs1186055

MAF

0.396

0.367

Allele

0.760

1.134

 0.507-2.539

 

G > T

G/G

31 (37.8)

5 (33.3)

 

 

 

 

 

 

G/T

37 (45.1)

9 (60.0)

Dominant

1.000

0.823

 0.257-2.631

 

 

T/T

14 (17.1)

1 (6.7)

Recessive

0.454

2.883

 0.350-23.75

 

rs208296

MAF

0.335

0.367

Allele

0.739

0.872

 0.388-1.960

 

C > T

C/C

35 (42.7)

5 (33.3)

 

 

 

 

 

 

C/T

39 (47.6)

9 (60.0)

Dominant

0.578

0.671

 0.211-2.140

 

 

T/T

8 (9.8)

1 (6.7)

Recessive

1.000

1.514

 0.175-13.07

 

rs11065464

MAF

0.256

0.200

Allele

0.513

1.377

 0.527-3.600

 

C > A

C/C

44 (53.7)

10 (66.7)

 

 

 

 

 

 

C/A

34 (41.5)

4 (26.7)

Dominant

0.408

1.727

 0.543-5.498

 

 

A/A

4 (4.9)

1 (6.7)

Recessive

0.577

0.718

 0.075-6.906

 

rs208307

MAF

0.140

0.233

Allele

0.195

0.536

 0.206-1.391

 

G > C

G/G

62 (75.6)

8 (53.3)

 

 

 

 

 

 

G/C

17 (20.7)

7 (46.7)

Dominant

0.077

0.369

 0.119-1.144

 

 

C/C

3 (3.7)

0 (0)

Recessive

1.000

1.365

 0.067-27.78

 

rs7958311

MAF

0.366

0.333

Allele

0.733

1.154

 0.507-2.627

 

G > A

G/G

34 (41.5)

7 (46.7)

 

 

 

 

 

 

G/A

36 (43.9)

6 (40.0)

Dominant

0.708

1.235

 0.409-3.731

 

 

A/A

12 (14.6)

2 (13.3)

Recessive

1.000

1.114

 0.223-5.574

 

rs1653609

MAF

0.293

0.300

Allele

0.936

0.966

 0.413-2.259

 

A > C

A/A

40 (48.8)

6 (40.0)

 

 

 

 

 

 

A/C

36 (43.9)

9 (60.0)

Dominant

0.531

0.700

 0.228-2.145

 

 

C/C

6 (7.3)

0 (0)

Recessive

0.586

2.634

 0.141-49.26

 

rs3751143

MAF

0.262

0.433

Allele

0.057

0.465

0.209-1.036

 

T > G

T/T

43 (52.4)

4 (26.7)

 

 

 

 

 

 

T/G

35 (42.7)

9 (60.0)

Dominant

0.092

0.330

 0.097-1.121

 

G/G

4 (4.9)

2 (13.3)

Recessive

0.232

0.333

 0.055-2.009

CARD8

rs1971783

MAF

0.512

0.367

Allele

0.143

1.814

 0.812-4.049

 

T > C

T/T

17 (20.7)

4 (26.7)

 

 

 

 

 

 

T/C

46 (56.1)

11 (73.3)

Dominant

0.733

1.390

 0.393-4.916

 

 

C/C

19 (23.2)

0 (0)

Recessive

0.037

0.105

 0.006-1.838

 

rs4389238

MAF

0.274

0.233

Allele

0.641

1.243

 0.499-3.096

 

C > T

C/C

43 (52.4)

9 (60.0)

 

 

 

 

 

 

C/T

33 (40.2)

5 (33.3)

Dominant

0.589

1.361

 0.444-4.170

 

 

T/T

6 (7.3)

1 (6.7)

Recessive

1.000

1.105

 0.123-9.901

 

rs4802448

MAF

0.299

0.367

Allele

0.460

0.736

 0.326-1.662

 

G > A

G/G

41 (50.0)

7 (46.7)

 

 

 

 

 

 

G/A

33 (40.2)

5 (33.3)

Dominant

0.812

0.875

 0.290-2.636

 

 

A/A

8 (9.8)

3 (20.0)

Recessive

0.368

0.432

 0.100-1.863

 

rs4802449

MAF

0.201

0.300

Allele

0.227

0.588

 0.246-1.402

 

G > A

G/G

52 (63.4)

8 (53.3)

 

 

 

 

 

 

G/A

27 (32.9)

5 (33.3)

Dominant

0.460

0.659

 0.217-2.000

 

 

A/A

3 (3.7)

2 (13.3)

Recessive

0.170

0.247

 0.038-1.622

 

rs10418189

MAF

0.506

0.333

Allele

0.082

2.049

 0.904-4.647

 

G > A

G/G

20 (24.4)

5 (33.3)

 

 

 

 

 

 

G/A

41 (50.0)

10 (66.7)

Dominant

0.525

1.550

 0.473-5.074

 

 

A/A

21 (25.6)

0 (0)

Recessive

0.036

10.840

 0.621-189.0

rs16981845

MAF

0.037

0.033

Allele

1.000

1.101

0.128-9.524

T > C

T/T

76 (92.7)

14 (93.3)

 

 

 

 

 

T/C

6 (7.3)

1 (6.7)

Dominant

1.000

0.905

 0.101-8.108

 

C/C

0 (0)

0 (0)

Recessive

-

-

-

rs11670259

MAF

0.152

0.267

Allele

0.126

0.495

 0.198-1.234

C > T

C/C

59 (72.0)

8 (53.3)

 

 

 

 

 

C/T

21 (25.6)

6 (40.0)

Dominant

0.152

0.446

 0.145-1.369

 

T/T

2 (2.4)

1 (6.7)

Recessive

0.399

0.350

 0.030-4.124

rs12984929

MAF

0.341

0.400

Allele

0.537

0.778

 0.350-1.729

G > T

G/G

38 (46.3)

6 (40.0)

 

 

 

 

 

G/T

32 (39.0)

6 (40.0)

Dominant

0.650

0.772

 0.252-2.367

 

T/T

12 (14.6)

3 (20.0)

Recessive

0.697

0.686

 0.168-2.796

rs11672725

MAF

0.171

0.267

Allele

0.214

0.566

 0.229-1.401

C > T

C/C

55 (67.1)

8 (53.3)

 

 

 

 

 

C/T

26 (31.7)

6 (40.0)

Dominant

0.305

0.561

 0.184-1.709

 

T/T

1 (1.2)

 1 (6.7)

Recessive

0.287

0.173

 0.010-2.927

rs6509368

MAF

0.372

0.400

Allele

0.771

0.888

 0.401-1.969

G > A

G/G

35 (42.7)

6 (40.0)

 

 

 

 

 

G/A

33 (40.2)

6 (40.0)

Dominant

0.847

0.895

 0.292-2.749

A/A

14 (17.1)

3 (20.0)

Recessive

0.723

0.824

 0.205-3.306

PYCARD

rs8056505

MAF

0.177

0.100

Allele

0.424

1.933

 0.549-6.807

 

T > C

T/T

56 (68.3)

12 (80.0)

 

 

 

 

 

 

T/C

23 (28.0)

2 (20.0)

Dominant

0.542

1.857

 0.482-7.148

 

C/C

3 (3.7)

0 (0)

Recessive

1.000

1.365

 0.067-27.78

CASP1

rs2282659

MAF

0.317

0.267

Allele

0.583

1.277

 0.533-3.058

 

A > G

A/A

35 (42.7)

8 (53.3)

 

 

 

 

 

 

A/G

42 (51.2)

6 (40.0)

Dominant

0.445

1.535

 0.508-4.632

 

G/G

5 (6.1)

1 (6.7)

Recessive

1.000

0.909

 0.099-8.382

IL18

rs5744247

MAF

0.457

0.367

Allele

0.358

1.456

 0.652-3.251

 

C > G

C/C

24 (29.3)

5 (33.3)

 

 

 

 

 

 

C/G

41 (50.0)

9 (60.0)

Dominant

0.765

1.208

 0.373-3.909

 

G/G

17 (20.7)

1 (6.7)

Recessive

0.290

3.662

 0.449-29.85

 

rs2043055

MAF

0.409

0.400

Allele

0.930

1.036

 0.468-2.292

 

A > G

A/A

30 (36.6)

5 (33.3)

 

 

 

 

 

 

A/G

37 (45.1)

8 (53.3)

Dominant

1.000

0.867

 0.271-2.775

 

G/G

15 (18.3)

2 (13.3)

Recessive

1.000

1.455

 0.297-7.138

 

rs7106524

MAF

0.396

0.433

Allele

0.704

0.859

 0.391-1.886

 

G > A

G/G

29 (35.4)

5 (33.3)

 

 

 

 

 

 

G/A

41 (50.0)

7 (46.7)

Dominant

1.000

0.914

 0.285-2.930

 

A/A

12 (14.6)

3 (20.0)

Recessive

0.697

0.686

 0.168-2.796

 

rs360717

MAF

0.104

0.200

Allele

0.133

0.463

 0.166-1.290

 

C > G

C/C

66 (80.5)

9 (60.0)

 

 

 

 

 

 

C/G

15 (18.3)

6 (40.0)

Dominant

0.082

0.364

 0.113-1.170

 

G/G

1 (1.2)

0 (0)

Recessive

1.000

0.571

 0.022-14.67

IL1B

rs1143643

MAF

0.415

0.500

Allele

0.385

0.708

0.325-1.546

 

G > A

G/G

27 (32.9)

4 (26.7)

 

 

 

 

 

 

G/A

42 (51.2)

7 (46.7)

Dominant

0.768

0.741

 0.216-2.543

 

A/A

13 (15.9)

4 (26.7)

Recessive

0.293

0.518

 0.143-1.880

 

rs1143633

MAF

0.396

0.500

Allele

0.289

0.657

 0.301-1.434

 

A > G

A/A

27 (32.9)

4 (26.7)

 

 

 

 

 

 

A/G

45 (54.9)

7 (46.7)

Dominant

0.768

0.741

 0.216-2.543

 

G/G

10 (12.2)

4 (26.7)

Recessive

0.222

0.382

 0.102-1.432

 

rs3136558

MAF

0.470

0.467

Allele

0.977

1.012

 0.464-2.207

 

T > C

T/T

21 (25.6)

4 (26.7)

 

 

 

 

 

 

T/C

45 (54.9)

8 (53.3)

Dominant

1.000

1.056

 0.303-3.676

 

C/C

16 (19.5)

3 (20.0)

Recessive

1.000

0.970

 0.244-3.846

 

rs1143630

MAF

0.152

0.100

Allele

0.580

1.619

 0.456-5.744

 

C > A

C/C

60 (73.2)

12 (80.0)

 

 

 

 

 

 

C/A

19 (23.2)

3 (20.0)

Dominant

0.753

1.467

 0.378-5.692

 

 

A/A

3 (3.7)

0 (0)

Recessive

1.000

1.365

 0.067-27.780

 

rs16944

MAF

0.445

0.467

Allele

0.827

0.917

 0.420-2.001

 

G > A

G/G

26 (31.7)

4 (26.7)

 

 

 

 

 

 

G/A

29 (47.6)

8 (53.3)

Dominant

0.772

0.783

 0.228-2.694

 

A/A

17 (20.7)

3 (20.0)

Recessive

1.000

1.046

 0.265-4.131

rs1143623

MAF

0.354

0.333

Allele

0.830

1.094

 0.480-2.494

G > C

G/G

35 (42.7)

7 (46.7)

 

 

 

 

 

G/C

36 (43.9)

6 (40.0)

Dominant

0.775

1.175

 0.389-3.547

C/C

11 (13.4)

2 (13.3)

Recessive

1.000

1.007

 0.200-5.081

Table 5. Allele and genotype comparisons in three inheritance models between responders and non-responders to IFX after 2 years of treatment for CD patients.

* Allele: allele model; Dominant: the minor allele dominant model; Recessive: the minor allele recessive model. (IFX, infliximab; CD, Crohn's disease; SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval; MAF, minor allele frequency).

Factor

OR (95% CI)

P value*

 
 

C/C genotype of rs11670259 in CARD8

5.391 (1.352 - 21.49)

0.017

 

G/G genotype of rs1143623 in IL1B

8.293 (0.966 - 71.21)

0.054

 

Female

7.364 (0.852 - 63.62)

0.070

 

Table 6. The interaction of genetic and environmental factors for response to IFX after 10 weeks of treatment for CD patients.

*Factors were statistically analyzed by multivariate logistic regression analysis.( IFX, infliximab; CD, Crohn's disease; OR, odds ratio; CI, confidence interval).

 

Factor

 

OR (95% CI)

 

P value*

 
 

T/T or T/G genotype of rs3751143 in P2RX7

6.379 (1.498 - 27.17)

0.012

 

C/C genotype of rs4389238 in CARD8

5.114 (1.416 - 18.48)

0.013

 

A/G or G/G genotype of rs2282659 in CASP1

7.803 (1.938 - 31.42)

0.004

 

Table 7. Gene-gene interaction among P2RX7, CARD8, and CASP1 genotypes for response to IFX after 1 year of treatment for CD patients.

*Factors were statistically analyzed by multivariate logistic regression analysis. (IFX, infliximab; CD, Crohn's disease; OR, odds ratio; CI, confidence interval).

Biomarker

Statistical results

Genetic diagnosis

OR (95% CI)

P value*

sensitivity

specificity

PPV

NPV

C/C genotype of rs11670259 in CARD8

3.736 (1.029 - 13.57)

0.047

68.1

63.6

95.2

15.9

Table 8. Genetic factor determined by genetic test for response to IFX after 10 weeks of treatment for CD patients.

*Factors were statistically analyzed by Fisher's exact test. (IFX, infliximab; CD, crohn's disease; OR, odds ratio; CI, confidence interval; PPV, positive predictive value; NPV, negative predictive value).

Biomarker

P2RX7

CARD8

CASP1

Statistical results

Genetic diagnosis

rs3751143

rs4389238

rs2282659

OR (95% CI)

P value*

sensitivity

specificity

PPV

NPV

marker 1

T/T or T/G

-

-

7.000 (1.961 - 24.99)

0.004

93.8

31.6

87.5

50.0

marker 2

-

C/C

-

4.333 (1.341 - 14.01)

0.012

53.6

78.9

92.9

25.0

marker 3

-

-

A/G or G/G

6.698 (1.831 - 24.50)

0.002

55.7

84.2

94.7

27.1

marker 4

T/T or T/G

C/C

-

5.444 (1.490 - 19.90)

0.006

50.5

84.2

94.2

25.0

marker 5

-

C/C

A/G or G/G

6.592 (0.837 - 51.91)

0.071

26.8

94.7

96.3

20.2

marker 6

T/T or T/G

-

A/G or G/G

9.424 (2.064 - 43.04)

0.001

52.6

89.5

96.2

27.0

marker 7

T/T or T/G

C/C

A/G or G/G

6.250 (0.792 - 49.28)

0.069

25.8

94.7

96.2

20.0

Table 9. Combination of genetic factors determined by genetic test for response to IFX after 1 year of treatment for CD patients. *Factors were statistically analyzed by Fisher's exact test. (IFX, infliximab; CD, crohn's disease; OR, odds ratio; CI, confidence interval; PPV, positive predictive value; NPV, negative predictive value)